Incidental Mutation 'R9414:Gdap2'
ID 711928
Institutional Source Beutler Lab
Gene Symbol Gdap2
Ensembl Gene ENSMUSG00000027865
Gene Name ganglioside-induced differentiation-associated-protein 2
Synonyms D3Ertd801e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9414 (G1)
Quality Score 223.009
Status Not validated
Chromosome 3
Chromosomal Location 100162381-100206981 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 100182755 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029459] [ENSMUST00000106997]
AlphaFold Q9DBL2
Predicted Effect probably null
Transcript: ENSMUST00000029459
SMART Domains Protein: ENSMUSP00000029459
Gene: ENSMUSG00000027865

DomainStartEndE-ValueType
Pfam:Macro 72 185 1.3e-30 PFAM
low complexity region 265 274 N/A INTRINSIC
SEC14 334 482 5.41e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106997
SMART Domains Protein: ENSMUSP00000102610
Gene: ENSMUSG00000027865

DomainStartEndE-ValueType
Pfam:Macro 72 185 4.4e-32 PFAM
low complexity region 265 274 N/A INTRINSIC
SEC14 334 482 5.41e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,144,274 I689K probably damaging Het
Agtpbp1 G T 13: 59,462,088 T1076K probably damaging Het
Ammecr1l A G 18: 31,771,909 T68A probably benign Het
Arvcf A G 16: 18,397,715 E264G probably damaging Het
Cacna1b C T 2: 24,648,502 D1542N probably damaging Het
Cacna2d2 A G 9: 107,515,196 T512A probably damaging Het
Crebbp A G 16: 4,107,492 C1213R probably damaging Het
Cybrd1 G T 2: 71,118,223 R35L probably damaging Het
Dcaf1 G A 9: 106,879,959 W1412* probably null Het
Eif4e T A 3: 138,547,734 D67E probably benign Het
Epb41 G A 4: 131,974,851 T491I probably damaging Het
Fez1 G A 9: 36,867,951 S308N probably benign Het
Fgfr3 A G 5: 33,729,954 S206G possibly damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gfpt1 T A 6: 87,085,283 D541E probably benign Het
Gm38394 T C 1: 133,657,277 D774G probably damaging Het
Gm5089 A G 14: 122,436,192 F39S unknown Het
Gm7694 C T 1: 170,302,604 G75D probably benign Het
Gpr15 A G 16: 58,718,153 L191S probably benign Het
Hmcn1 T G 1: 150,669,436 T2807P probably damaging Het
Iqgap2 T C 13: 95,646,841 T1276A Het
Itgae G T 11: 73,111,803 A129S possibly damaging Het
Kcns1 T C 2: 164,168,458 E127G probably damaging Het
Kmt2b T C 7: 30,582,882 E1118G probably damaging Het
Lair1 T C 7: 4,010,820 I143V probably benign Het
Lcmt2 T C 2: 121,140,140 D154G possibly damaging Het
Ly9 T C 1: 171,599,707 T427A probably damaging Het
Man2c1 A G 9: 57,136,746 T281A possibly damaging Het
Map4k2 T C 19: 6,344,485 F332L probably benign Het
Mmp10 A T 9: 7,502,488 D32V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Npnt T C 3: 132,906,355 N300S probably benign Het
Olfr1443 T C 19: 12,680,348 V80A probably benign Het
Olfr178 G A 16: 58,890,202 T6I probably benign Het
Olfr53 C A 7: 140,652,350 R124S probably damaging Het
Pacsin1 T C 17: 27,708,011 V387A probably damaging Het
Pald1 G T 10: 61,343,153 A489E probably benign Het
Pcnx G T 12: 81,918,204 G382W probably damaging Het
Pde6b T A 5: 108,419,726 M294K possibly damaging Het
Phf20 T C 2: 156,294,247 V662A probably benign Het
Plcg1 T C 2: 160,761,356 I1149T possibly damaging Het
Prdx2 T C 8: 84,970,567 S79P probably damaging Het
Rab19 T C 6: 39,383,921 M1T probably null Het
Retn T G 8: 3,656,908 F44C probably damaging Het
Rp1 A T 1: 4,243,618 W507R unknown Het
Rsf1 A C 7: 97,664,558 probably null Het
Ryr3 C T 2: 112,670,666 E3561K possibly damaging Het
Scaf1 T A 7: 45,003,292 Y1220F unknown Het
Sowahc A G 10: 59,222,669 K209R probably benign Het
Supt20 T A 3: 54,703,083 I103N probably damaging Het
Tenm4 A G 7: 96,896,160 E2498G probably benign Het
Tet1 T C 10: 62,839,156 N1047S probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tldc1 A T 8: 119,768,342 S226T probably benign Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Uggt1 T C 1: 36,184,426 E594G probably benign Het
Vmn2r104 T A 17: 20,029,988 I674F probably damaging Het
Zcchc4 T C 5: 52,796,622 S215P probably benign Het
Zfc3h1 T G 10: 115,414,011 S1177A possibly damaging Het
Zfp646 G A 7: 127,881,878 A1076T probably damaging Het
Zfp735 T A 11: 73,711,197 Y322* probably null Het
Other mutations in Gdap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Gdap2 APN 3 100170927 missense possibly damaging 0.62
IGL02342:Gdap2 APN 3 100178316 missense probably damaging 1.00
IGL02684:Gdap2 APN 3 100171020 missense probably benign 0.13
R0128:Gdap2 UTSW 3 100201995 missense probably damaging 1.00
R0130:Gdap2 UTSW 3 100201995 missense probably damaging 1.00
R0344:Gdap2 UTSW 3 100178256 missense probably damaging 1.00
R0588:Gdap2 UTSW 3 100170001 start codon destroyed probably null 1.00
R1521:Gdap2 UTSW 3 100194615 missense possibly damaging 0.61
R2168:Gdap2 UTSW 3 100187883 missense probably benign
R3040:Gdap2 UTSW 3 100188035 critical splice donor site probably null
R4793:Gdap2 UTSW 3 100170918 missense probably damaging 1.00
R5406:Gdap2 UTSW 3 100191675 missense probably damaging 1.00
R5438:Gdap2 UTSW 3 100178313 missense probably damaging 1.00
R5987:Gdap2 UTSW 3 100202256 intron probably benign
R6816:Gdap2 UTSW 3 100191705 critical splice donor site probably null
R7307:Gdap2 UTSW 3 100202033 missense unknown
R7424:Gdap2 UTSW 3 100202066 missense unknown
R7673:Gdap2 UTSW 3 100191699 missense probably benign 0.01
R8221:Gdap2 UTSW 3 100202295 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGTAATTGAGCAGAGCC -3'
(R):5'- TGGACTTGGCAACCAGTACAG -3'

Sequencing Primer
(F):5'- TGGGTAATTGAGCAGAGCCTGATG -3'
(R):5'- ACCAGTACAGCGTGGTTTAC -3'
Posted On 2022-05-16