Incidental Mutation 'R9414:Tet1'
ID 711956
Institutional Source Beutler Lab
Gene Symbol Tet1
Ensembl Gene ENSMUSG00000047146
Gene Name tet methylcytosine dioxygenase 1
Synonyms BB001228, 2510010B09Rik, D10Ertd17e, Cxxc6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9414 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 62804570-62908996 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 62839156 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1047 (N1047S)
Ref Sequence ENSEMBL: ENSMUSP00000133279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174189]
AlphaFold Q3URK3
Predicted Effect probably benign
Transcript: ENSMUST00000050826
AA Change: N1047S

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: N1047S

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.5e-11 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1931 1e-171 SMART
low complexity region 1944 1956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174189
AA Change: N1047S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: N1047S

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.7e-10 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1963 7.36e-170 SMART
low complexity region 1976 1988 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,144,274 I689K probably damaging Het
Agtpbp1 G T 13: 59,462,088 T1076K probably damaging Het
Ammecr1l A G 18: 31,771,909 T68A probably benign Het
Arvcf A G 16: 18,397,715 E264G probably damaging Het
Cacna1b C T 2: 24,648,502 D1542N probably damaging Het
Cacna2d2 A G 9: 107,515,196 T512A probably damaging Het
Crebbp A G 16: 4,107,492 C1213R probably damaging Het
Cybrd1 G T 2: 71,118,223 R35L probably damaging Het
Dcaf1 G A 9: 106,879,959 W1412* probably null Het
Eif4e T A 3: 138,547,734 D67E probably benign Het
Epb41 G A 4: 131,974,851 T491I probably damaging Het
Fez1 G A 9: 36,867,951 S308N probably benign Het
Fgfr3 A G 5: 33,729,954 S206G possibly damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gdap2 T C 3: 100,182,755 probably null Het
Gfpt1 T A 6: 87,085,283 D541E probably benign Het
Gm38394 T C 1: 133,657,277 D774G probably damaging Het
Gm5089 A G 14: 122,436,192 F39S unknown Het
Gm7694 C T 1: 170,302,604 G75D probably benign Het
Gpr15 A G 16: 58,718,153 L191S probably benign Het
Hmcn1 T G 1: 150,669,436 T2807P probably damaging Het
Iqgap2 T C 13: 95,646,841 T1276A Het
Itgae G T 11: 73,111,803 A129S possibly damaging Het
Kcns1 T C 2: 164,168,458 E127G probably damaging Het
Kmt2b T C 7: 30,582,882 E1118G probably damaging Het
Lair1 T C 7: 4,010,820 I143V probably benign Het
Lcmt2 T C 2: 121,140,140 D154G possibly damaging Het
Ly9 T C 1: 171,599,707 T427A probably damaging Het
Man2c1 A G 9: 57,136,746 T281A possibly damaging Het
Map4k2 T C 19: 6,344,485 F332L probably benign Het
Mmp10 A T 9: 7,502,488 D32V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Npnt T C 3: 132,906,355 N300S probably benign Het
Olfr1443 T C 19: 12,680,348 V80A probably benign Het
Olfr178 G A 16: 58,890,202 T6I probably benign Het
Olfr53 C A 7: 140,652,350 R124S probably damaging Het
Pacsin1 T C 17: 27,708,011 V387A probably damaging Het
Pald1 G T 10: 61,343,153 A489E probably benign Het
Pcnx G T 12: 81,918,204 G382W probably damaging Het
Pde6b T A 5: 108,419,726 M294K possibly damaging Het
Phf20 T C 2: 156,294,247 V662A probably benign Het
Plcg1 T C 2: 160,761,356 I1149T possibly damaging Het
Prdx2 T C 8: 84,970,567 S79P probably damaging Het
Rab19 T C 6: 39,383,921 M1T probably null Het
Retn T G 8: 3,656,908 F44C probably damaging Het
Rp1 A T 1: 4,243,618 W507R unknown Het
Rsf1 A C 7: 97,664,558 probably null Het
Ryr3 C T 2: 112,670,666 E3561K possibly damaging Het
Scaf1 T A 7: 45,003,292 Y1220F unknown Het
Sowahc A G 10: 59,222,669 K209R probably benign Het
Supt20 T A 3: 54,703,083 I103N probably damaging Het
Tenm4 A G 7: 96,896,160 E2498G probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tldc1 A T 8: 119,768,342 S226T probably benign Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Uggt1 T C 1: 36,184,426 E594G probably benign Het
Vmn2r104 T A 17: 20,029,988 I674F probably damaging Het
Zcchc4 T C 5: 52,796,622 S215P probably benign Het
Zfc3h1 T G 10: 115,414,011 S1177A possibly damaging Het
Zfp646 G A 7: 127,881,878 A1076T probably damaging Het
Zfp735 T A 11: 73,711,197 Y322* probably null Het
Other mutations in Tet1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Tet1 APN 10 62814497 missense probably damaging 1.00
IGL01079:Tet1 APN 10 62879473 missense probably damaging 0.99
IGL01109:Tet1 APN 10 62879774 missense probably benign
IGL01634:Tet1 APN 10 62878588 missense possibly damaging 0.94
IGL02003:Tet1 APN 10 62816400 missense possibly damaging 0.92
IGL02081:Tet1 APN 10 62813818 missense probably damaging 1.00
IGL02100:Tet1 APN 10 62812728 missense possibly damaging 0.92
IGL02228:Tet1 APN 10 62813734 missense probably damaging 0.99
IGL02524:Tet1 APN 10 62878646 missense probably damaging 1.00
IGL02539:Tet1 APN 10 62813019 missense possibly damaging 0.60
IGL02608:Tet1 APN 10 62879609 missense possibly damaging 0.82
IGL02608:Tet1 APN 10 62839087 missense probably damaging 1.00
IGL02702:Tet1 APN 10 62879752 missense possibly damaging 0.83
K7371:Tet1 UTSW 10 62879176 missense probably benign
R0166:Tet1 UTSW 10 62840279 missense probably benign 0.05
R0371:Tet1 UTSW 10 62878399 missense probably damaging 0.97
R0373:Tet1 UTSW 10 62878209 nonsense probably null
R0391:Tet1 UTSW 10 62814546 splice site probably null
R0445:Tet1 UTSW 10 62879941 missense probably benign 0.08
R1016:Tet1 UTSW 10 62879950 missense probably benign
R1344:Tet1 UTSW 10 62814521 missense probably damaging 1.00
R1546:Tet1 UTSW 10 62812910 missense probably damaging 1.00
R1651:Tet1 UTSW 10 62879674 missense probably damaging 1.00
R1725:Tet1 UTSW 10 62814477 missense probably damaging 1.00
R1752:Tet1 UTSW 10 62812989 missense probably damaging 0.99
R1834:Tet1 UTSW 10 62813665 missense probably damaging 0.99
R1964:Tet1 UTSW 10 62812947 missense possibly damaging 0.86
R2239:Tet1 UTSW 10 62879734 missense probably benign 0.01
R2962:Tet1 UTSW 10 62814544 nonsense probably null
R3084:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3086:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3972:Tet1 UTSW 10 62813726 missense probably damaging 1.00
R4622:Tet1 UTSW 10 62819474 missense possibly damaging 0.92
R4674:Tet1 UTSW 10 62838848 missense probably damaging 0.97
R4687:Tet1 UTSW 10 62838791 missense probably benign 0.04
R4718:Tet1 UTSW 10 62813812 missense probably damaging 0.96
R4801:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4802:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4903:Tet1 UTSW 10 62822658 missense probably damaging 1.00
R5153:Tet1 UTSW 10 62878578 missense possibly damaging 0.85
R5193:Tet1 UTSW 10 62838247 missense probably benign 0.22
R5225:Tet1 UTSW 10 62838671 missense probably damaging 1.00
R5437:Tet1 UTSW 10 62814451 missense probably benign 0.01
R5465:Tet1 UTSW 10 62839777 missense probably benign
R5535:Tet1 UTSW 10 62832907 missense probably damaging 1.00
R5586:Tet1 UTSW 10 62878294 missense probably damaging 1.00
R5763:Tet1 UTSW 10 62840068 missense probably damaging 1.00
R5788:Tet1 UTSW 10 62839958 missense possibly damaging 0.70
R5818:Tet1 UTSW 10 62816408 missense possibly damaging 0.71
R5860:Tet1 UTSW 10 62812620 splice site probably null
R5975:Tet1 UTSW 10 62879773 missense probably benign 0.37
R6041:Tet1 UTSW 10 62813373 missense probably damaging 0.98
R6092:Tet1 UTSW 10 62813715 missense probably benign 0.10
R6132:Tet1 UTSW 10 62813300 missense probably damaging 0.99
R6157:Tet1 UTSW 10 62839970 missense probably damaging 0.98
R6520:Tet1 UTSW 10 62880013 start codon destroyed probably null 0.53
R7210:Tet1 UTSW 10 62814501 missense probably null 0.95
R7223:Tet1 UTSW 10 62813671 missense possibly damaging 0.95
R7255:Tet1 UTSW 10 62822636 missense probably benign 0.15
R7323:Tet1 UTSW 10 62880039 start gained probably benign
R7472:Tet1 UTSW 10 62813350 missense possibly damaging 0.84
R7507:Tet1 UTSW 10 62832892 critical splice donor site probably null
R7522:Tet1 UTSW 10 62818983 missense possibly damaging 0.82
R7849:Tet1 UTSW 10 62819473 missense possibly damaging 0.83
R7879:Tet1 UTSW 10 62879046 missense probably benign 0.03
R8073:Tet1 UTSW 10 62813353 missense probably damaging 0.98
R8098:Tet1 UTSW 10 62879080 missense probably damaging 1.00
R8147:Tet1 UTSW 10 62878807 missense probably benign 0.01
R8355:Tet1 UTSW 10 62816450 missense possibly damaging 0.89
R8545:Tet1 UTSW 10 62812939 missense probably damaging 1.00
R8556:Tet1 UTSW 10 62840206 missense probably benign 0.37
R8936:Tet1 UTSW 10 62840284 nonsense probably null
R9173:Tet1 UTSW 10 62840286 missense probably benign
R9584:Tet1 UTSW 10 62819527 missense probably damaging 1.00
Z1177:Tet1 UTSW 10 62818985 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CATTTTCTTGAGAGCTTCGGGC -3'
(R):5'- TGAGAATTCACATCCATTGCCC -3'

Sequencing Primer
(F):5'- CTGGGGGTTTCTTTTTCCGC -3'
(R):5'- TGCCCATAGAAAGTCACAATCTTG -3'
Posted On 2022-05-16