Incidental Mutation 'R9414:Itgae'
ID 711959
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Name integrin alpha E, epithelial-associated
Synonyms alpha-E1, CD103
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9414 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72981409-73038272 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 73002629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 129 (A129S)
Ref Sequence ENSEMBL: ENSMUSP00000006101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
AlphaFold Q60677
Predicted Effect possibly damaging
Transcript: ENSMUST00000006101
AA Change: A129S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: A129S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102537
AA Change: A129S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: A129S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,035,100 (GRCm39) I689K probably damaging Het
Agtpbp1 G T 13: 59,609,902 (GRCm39) T1076K probably damaging Het
Ammecr1l A G 18: 31,904,962 (GRCm39) T68A probably benign Het
Arvcf A G 16: 18,215,580 (GRCm39) E264G probably damaging Het
Cacna1b C T 2: 24,538,514 (GRCm39) D1542N probably damaging Het
Cacna2d2 A G 9: 107,392,395 (GRCm39) T512A probably damaging Het
Crebbp A G 16: 3,925,356 (GRCm39) C1213R probably damaging Het
Cybrd1 G T 2: 70,948,567 (GRCm39) R35L probably damaging Het
Dcaf1 G A 9: 106,757,158 (GRCm39) W1412* probably null Het
Eif4e T A 3: 138,253,495 (GRCm39) D67E probably benign Het
Epb41 G A 4: 131,702,162 (GRCm39) T491I probably damaging Het
Fez1 G A 9: 36,779,247 (GRCm39) S308N probably benign Het
Fgfr3 A G 5: 33,887,298 (GRCm39) S206G possibly damaging Het
Flcn A T 11: 59,684,998 (GRCm39) N484K possibly damaging Het
Gdap2 T C 3: 100,090,071 (GRCm39) probably null Het
Gfpt1 T A 6: 87,062,265 (GRCm39) D541E probably benign Het
Gm5089 A G 14: 122,673,604 (GRCm39) F39S unknown Het
Gm7694 C T 1: 170,130,173 (GRCm39) G75D probably benign Het
Gpr15 A G 16: 58,538,516 (GRCm39) L191S probably benign Het
Hmcn1 T G 1: 150,545,187 (GRCm39) T2807P probably damaging Het
Iqgap2 T C 13: 95,783,349 (GRCm39) T1276A Het
Kcns1 T C 2: 164,010,378 (GRCm39) E127G probably damaging Het
Kmt2b T C 7: 30,282,307 (GRCm39) E1118G probably damaging Het
Lair1 T C 7: 4,013,819 (GRCm39) I143V probably benign Het
Lcmt2 T C 2: 120,970,621 (GRCm39) D154G possibly damaging Het
Ly9 T C 1: 171,427,275 (GRCm39) T427A probably damaging Het
Man2c1 A G 9: 57,044,030 (GRCm39) T281A possibly damaging Het
Map4k2 T C 19: 6,394,515 (GRCm39) F332L probably benign Het
Meak7 A T 8: 120,495,081 (GRCm39) S226T probably benign Het
Mmp10 A T 9: 7,502,489 (GRCm39) D32V probably benign Het
Mroh2a C T 1: 88,179,096 (GRCm39) R1110W probably benign Het
Naip2 T A 13: 100,298,243 (GRCm39) S598C probably damaging Het
Npnt T C 3: 132,612,116 (GRCm39) N300S probably benign Het
Or13a20 C A 7: 140,232,263 (GRCm39) R124S probably damaging Het
Or5b95 T C 19: 12,657,712 (GRCm39) V80A probably benign Het
Or5k15 G A 16: 58,710,565 (GRCm39) T6I probably benign Het
Pacsin1 T C 17: 27,926,985 (GRCm39) V387A probably damaging Het
Pald1 G T 10: 61,178,932 (GRCm39) A489E probably benign Het
Pcnx1 G T 12: 81,964,978 (GRCm39) G382W probably damaging Het
Pde6b T A 5: 108,567,592 (GRCm39) M294K possibly damaging Het
Phf20 T C 2: 156,136,167 (GRCm39) V662A probably benign Het
Plcg1 T C 2: 160,603,276 (GRCm39) I1149T possibly damaging Het
Prdx2 T C 8: 85,697,196 (GRCm39) S79P probably damaging Het
Rab19 T C 6: 39,360,855 (GRCm39) M1T probably null Het
Retn T G 8: 3,706,908 (GRCm39) F44C probably damaging Het
Rp1 A T 1: 4,313,841 (GRCm39) W507R unknown Het
Rsf1 A C 7: 97,313,765 (GRCm39) probably null Het
Ryr3 C T 2: 112,501,011 (GRCm39) E3561K possibly damaging Het
Scaf1 T A 7: 44,652,716 (GRCm39) Y1220F unknown Het
Sowahc A G 10: 59,058,491 (GRCm39) K209R probably benign Het
Supt20 T A 3: 54,610,504 (GRCm39) I103N probably damaging Het
Tenm4 A G 7: 96,545,367 (GRCm39) E2498G probably benign Het
Tet1 T C 10: 62,674,935 (GRCm39) N1047S probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,650,884 (GRCm39) probably null Het
Tub T A 7: 108,626,265 (GRCm39) I267N probably damaging Het
Uggt1 T C 1: 36,223,507 (GRCm39) E594G probably benign Het
Vmn2r104 T A 17: 20,250,250 (GRCm39) I674F probably damaging Het
Zbed6 T C 1: 133,585,015 (GRCm39) D774G probably damaging Het
Zcchc4 T C 5: 52,953,964 (GRCm39) S215P probably benign Het
Zfc3h1 T G 10: 115,249,916 (GRCm39) S1177A possibly damaging Het
Zfp646 G A 7: 127,481,050 (GRCm39) A1076T probably damaging Het
Zfp735 T A 11: 73,602,023 (GRCm39) Y322* probably null Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73,036,461 (GRCm39) missense probably benign 0.17
IGL00472:Itgae APN 11 73,004,520 (GRCm39) missense probably benign 0.06
IGL00821:Itgae APN 11 73,013,974 (GRCm39) missense probably damaging 1.00
IGL01625:Itgae APN 11 73,010,263 (GRCm39) missense probably benign 0.00
IGL01639:Itgae APN 11 73,010,204 (GRCm39) missense probably benign 0.00
IGL01743:Itgae APN 11 73,002,585 (GRCm39) missense probably benign 0.02
IGL01911:Itgae APN 11 73,006,963 (GRCm39) missense probably damaging 1.00
IGL01949:Itgae APN 11 73,009,010 (GRCm39) missense probably benign 0.29
IGL02149:Itgae APN 11 72,994,720 (GRCm39) missense probably benign 0.04
IGL02179:Itgae APN 11 73,024,844 (GRCm39) missense probably benign 0.06
IGL02231:Itgae APN 11 72,981,448 (GRCm39) missense possibly damaging 0.88
IGL02292:Itgae APN 11 73,009,361 (GRCm39) missense probably damaging 0.98
IGL02378:Itgae APN 11 73,008,947 (GRCm39) missense probably benign 0.00
IGL02525:Itgae APN 11 73,021,777 (GRCm39) missense probably damaging 0.98
IGL02576:Itgae APN 11 73,009,331 (GRCm39) missense possibly damaging 0.95
IGL02729:Itgae APN 11 73,009,029 (GRCm39) splice site probably benign
IGL02859:Itgae APN 11 73,005,693 (GRCm39) missense probably damaging 1.00
IGL03074:Itgae APN 11 73,016,136 (GRCm39) missense probably benign 0.00
IGL03107:Itgae APN 11 73,004,427 (GRCm39) missense probably damaging 1.00
IGL03264:Itgae APN 11 73,006,400 (GRCm39) missense possibly damaging 0.73
IGL03272:Itgae APN 11 73,024,680 (GRCm39) splice site probably null
IGL03352:Itgae APN 11 73,022,556 (GRCm39) missense probably damaging 1.00
R0134:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0225:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0320:Itgae UTSW 11 73,021,825 (GRCm39) missense possibly damaging 0.74
R0344:Itgae UTSW 11 73,008,973 (GRCm39) missense probably benign 0.13
R0403:Itgae UTSW 11 73,014,009 (GRCm39) missense possibly damaging 0.89
R0631:Itgae UTSW 11 73,005,733 (GRCm39) missense probably damaging 1.00
R0833:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0836:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0973:Itgae UTSW 11 73,029,335 (GRCm39) nonsense probably null
R1231:Itgae UTSW 11 73,010,205 (GRCm39) missense probably benign 0.02
R1389:Itgae UTSW 11 73,016,188 (GRCm39) missense probably damaging 1.00
R1433:Itgae UTSW 11 73,006,418 (GRCm39) missense probably damaging 1.00
R1534:Itgae UTSW 11 73,036,431 (GRCm39) missense possibly damaging 0.58
R1833:Itgae UTSW 11 73,007,988 (GRCm39) missense possibly damaging 0.94
R1914:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R1915:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R2061:Itgae UTSW 11 73,009,448 (GRCm39) missense probably benign 0.00
R2380:Itgae UTSW 11 73,036,395 (GRCm39) missense probably benign 0.00
R2435:Itgae UTSW 11 73,012,763 (GRCm39) nonsense probably null
R2680:Itgae UTSW 11 73,005,752 (GRCm39) missense probably damaging 1.00
R2886:Itgae UTSW 11 73,031,513 (GRCm39) missense probably benign 0.04
R3873:Itgae UTSW 11 73,004,442 (GRCm39) missense probably damaging 1.00
R3923:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R4010:Itgae UTSW 11 73,002,165 (GRCm39) missense probably benign 0.00
R4059:Itgae UTSW 11 73,002,960 (GRCm39) missense probably benign
R4212:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4213:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4691:Itgae UTSW 11 73,010,345 (GRCm39) nonsense probably null
R4736:Itgae UTSW 11 73,005,706 (GRCm39) missense possibly damaging 0.79
R5152:Itgae UTSW 11 73,021,821 (GRCm39) missense probably damaging 1.00
R5201:Itgae UTSW 11 73,001,382 (GRCm39) missense probably benign 0.00
R5307:Itgae UTSW 11 73,036,464 (GRCm39) missense probably benign 0.00
R5362:Itgae UTSW 11 73,002,675 (GRCm39) missense probably damaging 1.00
R5448:Itgae UTSW 11 73,024,734 (GRCm39) critical splice donor site probably null
R5645:Itgae UTSW 11 73,020,074 (GRCm39) missense probably damaging 1.00
R5672:Itgae UTSW 11 73,036,377 (GRCm39) missense possibly damaging 0.96
R6079:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6138:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6226:Itgae UTSW 11 73,031,583 (GRCm39) missense probably benign 0.11
R6244:Itgae UTSW 11 73,036,427 (GRCm39) missense probably damaging 0.96
R6326:Itgae UTSW 11 73,022,519 (GRCm39) missense possibly damaging 0.88
R6332:Itgae UTSW 11 73,002,228 (GRCm39) splice site probably null
R6502:Itgae UTSW 11 73,036,418 (GRCm39) missense probably benign 0.10
R6825:Itgae UTSW 11 73,009,322 (GRCm39) missense possibly damaging 0.89
R7016:Itgae UTSW 11 73,010,342 (GRCm39) missense probably damaging 0.99
R7020:Itgae UTSW 11 73,002,195 (GRCm39) missense probably damaging 1.00
R7069:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R7132:Itgae UTSW 11 73,002,184 (GRCm39) missense possibly damaging 0.93
R7473:Itgae UTSW 11 73,031,504 (GRCm39) missense possibly damaging 0.87
R7599:Itgae UTSW 11 73,012,786 (GRCm39) missense possibly damaging 0.62
R7637:Itgae UTSW 11 73,004,457 (GRCm39) missense probably damaging 1.00
R7763:Itgae UTSW 11 73,014,095 (GRCm39) critical splice donor site probably null
R7829:Itgae UTSW 11 73,029,618 (GRCm39) missense probably benign
R7860:Itgae UTSW 11 73,011,099 (GRCm39) critical splice acceptor site probably null
R7978:Itgae UTSW 11 73,024,913 (GRCm39) missense probably damaging 0.98
R8197:Itgae UTSW 11 73,011,210 (GRCm39) missense probably benign
R8911:Itgae UTSW 11 73,004,447 (GRCm39) missense probably damaging 1.00
R9155:Itgae UTSW 11 73,016,089 (GRCm39) missense possibly damaging 0.94
R9284:Itgae UTSW 11 73,012,752 (GRCm39) missense probably benign 0.25
R9355:Itgae UTSW 11 73,006,906 (GRCm39) missense probably damaging 1.00
R9595:Itgae UTSW 11 73,016,182 (GRCm39) missense probably damaging 0.99
R9618:Itgae UTSW 11 73,011,171 (GRCm39) missense possibly damaging 0.78
U15987:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
X0024:Itgae UTSW 11 73,002,202 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1186:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1186:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1187:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1187:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1187:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1188:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1188:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1189:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1189:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1189:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1189:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1190:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1190:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1190:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1191:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1191:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1191:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1191:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1192:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1192:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1192:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CAGCACCTGATATCTGACCC -3'
(R):5'- GGATCATTAGCTCGTCCCTGAC -3'

Sequencing Primer
(F):5'- ACCTGATATCTGACCCTGAGGAGTG -3'
(R):5'- TGACCAGGACCCTGAGCTTG -3'
Posted On 2022-05-16