Incidental Mutation 'R9414:Zfp735'
ID 711960
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Name zinc finger protein 735
Synonyms 1700012C15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R9414 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 73688778-73713798 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 73711197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 322 (Y322*)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
AlphaFold B1ARH2
Predicted Effect probably null
Transcript: ENSMUST00000080407
AA Change: Y322*
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: Y322*

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,144,274 I689K probably damaging Het
Agtpbp1 G T 13: 59,462,088 T1076K probably damaging Het
Ammecr1l A G 18: 31,771,909 T68A probably benign Het
Arvcf A G 16: 18,397,715 E264G probably damaging Het
Cacna1b C T 2: 24,648,502 D1542N probably damaging Het
Cacna2d2 A G 9: 107,515,196 T512A probably damaging Het
Crebbp A G 16: 4,107,492 C1213R probably damaging Het
Cybrd1 G T 2: 71,118,223 R35L probably damaging Het
Dcaf1 G A 9: 106,879,959 W1412* probably null Het
Eif4e T A 3: 138,547,734 D67E probably benign Het
Epb41 G A 4: 131,974,851 T491I probably damaging Het
Fez1 G A 9: 36,867,951 S308N probably benign Het
Fgfr3 A G 5: 33,729,954 S206G possibly damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gdap2 T C 3: 100,182,755 probably null Het
Gfpt1 T A 6: 87,085,283 D541E probably benign Het
Gm38394 T C 1: 133,657,277 D774G probably damaging Het
Gm5089 A G 14: 122,436,192 F39S unknown Het
Gm7694 C T 1: 170,302,604 G75D probably benign Het
Gpr15 A G 16: 58,718,153 L191S probably benign Het
Hmcn1 T G 1: 150,669,436 T2807P probably damaging Het
Iqgap2 T C 13: 95,646,841 T1276A Het
Itgae G T 11: 73,111,803 A129S possibly damaging Het
Kcns1 T C 2: 164,168,458 E127G probably damaging Het
Kmt2b T C 7: 30,582,882 E1118G probably damaging Het
Lair1 T C 7: 4,010,820 I143V probably benign Het
Lcmt2 T C 2: 121,140,140 D154G possibly damaging Het
Ly9 T C 1: 171,599,707 T427A probably damaging Het
Man2c1 A G 9: 57,136,746 T281A possibly damaging Het
Map4k2 T C 19: 6,344,485 F332L probably benign Het
Mmp10 A T 9: 7,502,488 D32V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Npnt T C 3: 132,906,355 N300S probably benign Het
Olfr1443 T C 19: 12,680,348 V80A probably benign Het
Olfr178 G A 16: 58,890,202 T6I probably benign Het
Olfr53 C A 7: 140,652,350 R124S probably damaging Het
Pacsin1 T C 17: 27,708,011 V387A probably damaging Het
Pald1 G T 10: 61,343,153 A489E probably benign Het
Pcnx G T 12: 81,918,204 G382W probably damaging Het
Pde6b T A 5: 108,419,726 M294K possibly damaging Het
Phf20 T C 2: 156,294,247 V662A probably benign Het
Plcg1 T C 2: 160,761,356 I1149T possibly damaging Het
Prdx2 T C 8: 84,970,567 S79P probably damaging Het
Rab19 T C 6: 39,383,921 M1T probably null Het
Retn T G 8: 3,656,908 F44C probably damaging Het
Rp1 A T 1: 4,243,618 W507R unknown Het
Rsf1 A C 7: 97,664,558 probably null Het
Ryr3 C T 2: 112,670,666 E3561K possibly damaging Het
Scaf1 T A 7: 45,003,292 Y1220F unknown Het
Sowahc A G 10: 59,222,669 K209R probably benign Het
Supt20 T A 3: 54,703,083 I103N probably damaging Het
Tenm4 A G 7: 96,896,160 E2498G probably benign Het
Tet1 T C 10: 62,839,156 N1047S probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tldc1 A T 8: 119,768,342 S226T probably benign Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Uggt1 T C 1: 36,184,426 E594G probably benign Het
Vmn2r104 T A 17: 20,029,988 I674F probably damaging Het
Zcchc4 T C 5: 52,796,622 S215P probably benign Het
Zfc3h1 T G 10: 115,414,011 S1177A possibly damaging Het
Zfp646 G A 7: 127,881,878 A1076T probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73711366 missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73711560 missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73710479 missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73690365 missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73711428 missense probably benign 0.01
IGL02238:Zfp735 APN 11 73710493 missense probably benign 0.00
IGL02505:Zfp735 APN 11 73689800 missense probably benign 0.03
IGL02740:Zfp735 APN 11 73710586 missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73710929 missense probably benign 0.00
bananaquit UTSW 11 73710586 nonsense probably null
bescher UTSW 11 73712153 missense possibly damaging 0.93
Galvanic UTSW 11 73711678 nonsense probably null
grassquit UTSW 11 73712203 missense possibly damaging 0.66
R0114:Zfp735 UTSW 11 73710662 missense probably benign 0.33
R0217:Zfp735 UTSW 11 73711286 missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73712083 missense probably benign 0.04
R1421:Zfp735 UTSW 11 73710697 missense probably benign
R1460:Zfp735 UTSW 11 73712333 missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73710479 missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73710644 missense probably benign
R1676:Zfp735 UTSW 11 73711475 missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73711763 missense probably benign 0.01
R1871:Zfp735 UTSW 11 73710586 nonsense probably null
R1931:Zfp735 UTSW 11 73711851 missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73711025 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711396 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711397 nonsense probably null
R3552:Zfp735 UTSW 11 73711241 nonsense probably null
R3856:Zfp735 UTSW 11 73711456 missense probably benign 0.01
R3925:Zfp735 UTSW 11 73711124 missense probably benign 0.33
R4572:Zfp735 UTSW 11 73689785 missense probably benign 0.02
R4585:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73711205 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711855 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711856 missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73712113 missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73710593 nonsense probably null
R5516:Zfp735 UTSW 11 73710814 missense probably benign
R5654:Zfp735 UTSW 11 73712138 missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73690348 missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73711678 nonsense probably null
R6427:Zfp735 UTSW 11 73690314 missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73711652 missense probably benign 0.33
R6820:Zfp735 UTSW 11 73688957 start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73711054 missense probably benign 0.08
R6941:Zfp735 UTSW 11 73690333 missense probably benign 0.33
R7335:Zfp735 UTSW 11 73711553 missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73712153 missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73711176 missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73690328 missense possibly damaging 0.53
R7583:Zfp735 UTSW 11 73711107 missense possibly damaging 0.86
R7866:Zfp735 UTSW 11 73710803 missense probably benign 0.00
R8005:Zfp735 UTSW 11 73712314 nonsense probably null
R8500:Zfp735 UTSW 11 73710985 missense possibly damaging 0.53
R8551:Zfp735 UTSW 11 73712296 missense probably benign 0.06
R8754:Zfp735 UTSW 11 73712174 missense possibly damaging 0.85
R8769:Zfp735 UTSW 11 73690301 missense possibly damaging 0.53
R8794:Zfp735 UTSW 11 73712203 missense possibly damaging 0.66
R8835:Zfp735 UTSW 11 73710866 missense possibly damaging 0.53
R8869:Zfp735 UTSW 11 73711684 missense possibly damaging 0.53
R8969:Zfp735 UTSW 11 73711873 missense possibly damaging 0.83
R9072:Zfp735 UTSW 11 73712234 missense probably benign 0.21
R9073:Zfp735 UTSW 11 73712234 missense probably benign 0.21
R9193:Zfp735 UTSW 11 73689774 missense possibly damaging 0.71
R9355:Zfp735 UTSW 11 73711536 missense probably benign 0.01
R9456:Zfp735 UTSW 11 73711577 missense possibly damaging 0.53
R9573:Zfp735 UTSW 11 73712110 missense possibly damaging 0.67
Z1176:Zfp735 UTSW 11 73710815 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GAAGCAGTTGTGGGAACTCC -3'
(R):5'- TTATCATATCCCGGGGCCAG -3'

Sequencing Primer
(F):5'- ACAATCAACTTGGAGGGA -3'
(R):5'- AGGCATTCCTGTATATATCACATGTG -3'
Posted On 2022-05-16