Mutagenetix > Incidental Mutation

Incidental Mutation 'R9414:Vmn2r104'

711971

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r104

Ensembl Gene

ENSMUSG00000090315

Gene Name

vomeronasal 2, receptor 104

Synonyms

V2r7

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R9414 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20029425-20048205 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20029988 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 674 (I674F)

Ref Sequence

ENSEMBL: ENSMUSP00000129895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168050]

AlphaFold

E9Q2J5

Predicted Effect

probably damaging
Transcript: ENSMUST00000168050
AA Change: I674F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: I674F

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	85	457	4e-38	PFAM
Pfam:NCD3G	512	565	2.1e-20	PFAM
Pfam:7tm_3	598	833	1.7e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

98% (59/60)

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	T	11: 110,144,274	I689K	probably damaging	Het
Agtpbp1	G	T	13: 59,462,088	T1076K	probably damaging	Het
Ammecr1l	A	G	18: 31,771,909	T68A	probably benign	Het
Arvcf	A	G	16: 18,397,715	E264G	probably damaging	Het
Cacna1b	C	T	2: 24,648,502	D1542N	probably damaging	Het
Cacna2d2	A	G	9: 107,515,196	T512A	probably damaging	Het
Crebbp	A	G	16: 4,107,492	C1213R	probably damaging	Het
Cybrd1	G	T	2: 71,118,223	R35L	probably damaging	Het
Dcaf1	G	A	9: 106,879,959	W1412*	probably null	Het
Eif4e	T	A	3: 138,547,734	D67E	probably benign	Het
Epb41	G	A	4: 131,974,851	T491I	probably damaging	Het
Fez1	G	A	9: 36,867,951	S308N	probably benign	Het
Fgfr3	A	G	5: 33,729,954	S206G	possibly damaging	Het
Flcn	A	T	11: 59,794,172	N484K	possibly damaging	Het
Gdap2	T	C	3: 100,182,755		probably null	Het
Gfpt1	T	A	6: 87,085,283	D541E	probably benign	Het
Gm38394	T	C	1: 133,657,277	D774G	probably damaging	Het
Gm5089	A	G	14: 122,436,192	F39S	unknown	Het
Gm7694	C	T	1: 170,302,604	G75D	probably benign	Het
Gpr15	A	G	16: 58,718,153	L191S	probably benign	Het
Hmcn1	T	G	1: 150,669,436	T2807P	probably damaging	Het
Iqgap2	T	C	13: 95,646,841	T1276A		Het
Itgae	G	T	11: 73,111,803	A129S	possibly damaging	Het
Kcns1	T	C	2: 164,168,458	E127G	probably damaging	Het
Kmt2b	T	C	7: 30,582,882	E1118G	probably damaging	Het
Lair1	T	C	7: 4,010,820	I143V	probably benign	Het
Lcmt2	T	C	2: 121,140,140	D154G	possibly damaging	Het
Ly9	T	C	1: 171,599,707	T427A	probably damaging	Het
Man2c1	A	G	9: 57,136,746	T281A	possibly damaging	Het
Map4k2	T	C	19: 6,344,485	F332L	probably benign	Het
Mmp10	A	T	9: 7,502,488	D32V	probably benign	Het
Mroh2a	C	T	1: 88,251,374	R1110W	probably benign	Het
Naip2	T	A	13: 100,161,735	S598C	probably damaging	Het
Npnt	T	C	3: 132,906,355	N300S	probably benign	Het
Olfr1443	T	C	19: 12,680,348	V80A	probably benign	Het
Olfr178	G	A	16: 58,890,202	T6I	probably benign	Het
Olfr53	C	A	7: 140,652,350	R124S	probably damaging	Het
Pacsin1	T	C	17: 27,708,011	V387A	probably damaging	Het
Pald1	G	T	10: 61,343,153	A489E	probably benign	Het
Pcnx	G	T	12: 81,918,204	G382W	probably damaging	Het
Pde6b	T	A	5: 108,419,726	M294K	possibly damaging	Het
Phf20	T	C	2: 156,294,247	V662A	probably benign	Het
Plcg1	T	C	2: 160,761,356	I1149T	possibly damaging	Het
Prdx2	T	C	8: 84,970,567	S79P	probably damaging	Het
Rab19	T	C	6: 39,383,921	M1T	probably null	Het
Retn	T	G	8: 3,656,908	F44C	probably damaging	Het
Rp1	A	T	1: 4,243,618	W507R	unknown	Het
Rsf1	A	C	7: 97,664,558		probably null	Het
Ryr3	C	T	2: 112,670,666	E3561K	possibly damaging	Het
Scaf1	T	A	7: 45,003,292	Y1220F	unknown	Het
Sowahc	A	G	10: 59,222,669	K209R	probably benign	Het
Supt20	T	A	3: 54,703,083	I103N	probably damaging	Het
Tenm4	A	G	7: 96,896,160	E2498G	probably benign	Het
Tet1	T	C	10: 62,839,156	N1047S	probably benign	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tldc1	A	T	8: 119,768,342	S226T	probably benign	Het
Tub	T	A	7: 109,027,058	I267N	probably damaging	Het
Uggt1	T	C	1: 36,184,426	E594G	probably benign	Het
Zcchc4	T	C	5: 52,796,622	S215P	probably benign	Het
Zfc3h1	T	G	10: 115,414,011	S1177A	possibly damaging	Het
Zfp646	G	A	7: 127,881,878	A1076T	probably damaging	Het
Zfp735	T	A	11: 73,711,197	Y322*	probably null	Het

Other mutations in Vmn2r104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Vmn2r104	APN	17	20038239	missense	probably damaging	0.98
IGL01098:Vmn2r104	APN	17	20048096	missense	probably benign	0.27
IGL01333:Vmn2r104	APN	17	20042793	missense	probably benign	0.17
IGL01527:Vmn2r104	APN	17	20042896	missense	possibly damaging	0.82
IGL01773:Vmn2r104	APN	17	20040668	missense	probably benign	0.10
IGL01939:Vmn2r104	APN	17	20029925	missense	probably damaging	0.99
IGL02121:Vmn2r104	APN	17	20041794	nonsense	probably null
IGL02305:Vmn2r104	APN	17	20042856	missense	probably benign	0.09
IGL02374:Vmn2r104	APN	17	20042786	missense	probably benign	0.34
IGL03260:Vmn2r104	APN	17	20042821	missense	probably benign	0.05
IGL03366:Vmn2r104	APN	17	20029604	missense	probably damaging	1.00
R0091:Vmn2r104	UTSW	17	20041813	missense	possibly damaging	0.79
R0125:Vmn2r104	UTSW	17	20029807	missense	probably damaging	0.98
R0257:Vmn2r104	UTSW	17	20029627	missense	probably damaging	1.00
R0381:Vmn2r104	UTSW	17	20048002	nonsense	probably null
R0709:Vmn2r104	UTSW	17	20042904	missense	probably damaging	1.00
R0786:Vmn2r104	UTSW	17	20042725	missense	probably benign
R1575:Vmn2r104	UTSW	17	20042215	missense	probably damaging	1.00
R1827:Vmn2r104	UTSW	17	20042235	missense	probably damaging	0.97
R1932:Vmn2r104	UTSW	17	20040769	missense	probably damaging	1.00
R1956:Vmn2r104	UTSW	17	20042051	missense	probably damaging	0.98
R2203:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2205:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2859:Vmn2r104	UTSW	17	20048193	missense	possibly damaging	0.82
R3701:Vmn2r104	UTSW	17	20029556	missense	probably damaging	1.00
R3834:Vmn2r104	UTSW	17	20029921	missense	probably benign	0.02
R4151:Vmn2r104	UTSW	17	20029885	missense	probably damaging	1.00
R4470:Vmn2r104	UTSW	17	20042241	missense	probably damaging	1.00
R4625:Vmn2r104	UTSW	17	20048181	missense	probably benign	0.00
R4754:Vmn2r104	UTSW	17	20040768	nonsense	probably null
R4911:Vmn2r104	UTSW	17	20030026	missense	probably benign	0.00
R5270:Vmn2r104	UTSW	17	20038266	missense	probably damaging	1.00
R5279:Vmn2r104	UTSW	17	20041884	missense	probably benign	0.07
R5311:Vmn2r104	UTSW	17	20029901	missense	probably damaging	1.00
R5370:Vmn2r104	UTSW	17	20030188	missense	probably damaging	0.97
R5461:Vmn2r104	UTSW	17	20030081	missense	probably damaging	1.00
R5683:Vmn2r104	UTSW	17	20040719	nonsense	probably null
R5795:Vmn2r104	UTSW	17	20030110	missense	probably benign	0.02
R5795:Vmn2r104	UTSW	17	20030282	missense	possibly damaging	0.89
R5970:Vmn2r104	UTSW	17	20029471	missense	probably benign	0.01
R5983:Vmn2r104	UTSW	17	20041708	missense	probably damaging	1.00
R5992:Vmn2r104	UTSW	17	20029485	missense	probably damaging	1.00
R6066:Vmn2r104	UTSW	17	20038311	missense	possibly damaging	0.69
R6156:Vmn2r104	UTSW	17	20041647	missense	probably damaging	1.00
R6182:Vmn2r104	UTSW	17	20030245	missense	probably benign	0.16
R6245:Vmn2r104	UTSW	17	20041567	missense	possibly damaging	0.69
R6333:Vmn2r104	UTSW	17	20029586	missense	probably benign	0.30
R6573:Vmn2r104	UTSW	17	20042225	missense	probably damaging	1.00
R7101:Vmn2r104	UTSW	17	20030096	missense	possibly damaging	0.65
R7123:Vmn2r104	UTSW	17	20040826	missense	probably benign	0.12
R7485:Vmn2r104	UTSW	17	20029475	missense	probably benign	0.01
R7514:Vmn2r104	UTSW	17	20029529	missense	probably damaging	1.00
R7634:Vmn2r104	UTSW	17	20041709	missense	possibly damaging	0.48
R7958:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8031:Vmn2r104	UTSW	17	20042786	missense	probably benign	0.34
R8094:Vmn2r104	UTSW	17	20030221	missense	possibly damaging	0.77
R8191:Vmn2r104	UTSW	17	20030203	missense	possibly damaging	0.89
R8308:Vmn2r104	UTSW	17	20040778	missense	possibly damaging	0.55
R8691:Vmn2r104	UTSW	17	20041848	missense	probably damaging	0.98
R8795:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8900:Vmn2r104	UTSW	17	20041662	missense	probably damaging	0.99
R8913:Vmn2r104	UTSW	17	20029706	missense	probably damaging	1.00
R9180:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9199:Vmn2r104	UTSW	17	20041835	missense	probably damaging	0.99
R9282:Vmn2r104	UTSW	17	20040836	missense	probably damaging	1.00
R9303:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9305:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9322:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9325:Vmn2r104	UTSW	17	20048171	missense	possibly damaging	0.95
R9785:Vmn2r104	UTSW	17	20048147	missense	probably benign
RF007:Vmn2r104	UTSW	17	20048040	missense	probably benign	0.36
Z1177:Vmn2r104	UTSW	17	20029789	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAGCTGAGCCCTTGTTGC -3'
(R):5'- AGACACTCCTATTGTCAAGGCC -3'

Sequencing Primer
(F):5'- CTGAGCCCTTGTTGCACAAAAGG -3'
(R):5'- CTCCTATTGTCAAGGCCAATAATCGG -3'

Posted On

2022-05-16