Incidental Mutation 'R9414:Vmn2r104'
ID 711971
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Name vomeronasal 2, receptor 104
Synonyms V2r7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R9414 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20029425-20048205 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20029988 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 674 (I674F)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
AlphaFold E9Q2J5
Predicted Effect probably damaging
Transcript: ENSMUST00000168050
AA Change: I674F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: I674F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,144,274 I689K probably damaging Het
Agtpbp1 G T 13: 59,462,088 T1076K probably damaging Het
Ammecr1l A G 18: 31,771,909 T68A probably benign Het
Arvcf A G 16: 18,397,715 E264G probably damaging Het
Cacna1b C T 2: 24,648,502 D1542N probably damaging Het
Cacna2d2 A G 9: 107,515,196 T512A probably damaging Het
Crebbp A G 16: 4,107,492 C1213R probably damaging Het
Cybrd1 G T 2: 71,118,223 R35L probably damaging Het
Dcaf1 G A 9: 106,879,959 W1412* probably null Het
Eif4e T A 3: 138,547,734 D67E probably benign Het
Epb41 G A 4: 131,974,851 T491I probably damaging Het
Fez1 G A 9: 36,867,951 S308N probably benign Het
Fgfr3 A G 5: 33,729,954 S206G possibly damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gdap2 T C 3: 100,182,755 probably null Het
Gfpt1 T A 6: 87,085,283 D541E probably benign Het
Gm38394 T C 1: 133,657,277 D774G probably damaging Het
Gm5089 A G 14: 122,436,192 F39S unknown Het
Gm7694 C T 1: 170,302,604 G75D probably benign Het
Gpr15 A G 16: 58,718,153 L191S probably benign Het
Hmcn1 T G 1: 150,669,436 T2807P probably damaging Het
Iqgap2 T C 13: 95,646,841 T1276A Het
Itgae G T 11: 73,111,803 A129S possibly damaging Het
Kcns1 T C 2: 164,168,458 E127G probably damaging Het
Kmt2b T C 7: 30,582,882 E1118G probably damaging Het
Lair1 T C 7: 4,010,820 I143V probably benign Het
Lcmt2 T C 2: 121,140,140 D154G possibly damaging Het
Ly9 T C 1: 171,599,707 T427A probably damaging Het
Man2c1 A G 9: 57,136,746 T281A possibly damaging Het
Map4k2 T C 19: 6,344,485 F332L probably benign Het
Mmp10 A T 9: 7,502,488 D32V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Npnt T C 3: 132,906,355 N300S probably benign Het
Olfr1443 T C 19: 12,680,348 V80A probably benign Het
Olfr178 G A 16: 58,890,202 T6I probably benign Het
Olfr53 C A 7: 140,652,350 R124S probably damaging Het
Pacsin1 T C 17: 27,708,011 V387A probably damaging Het
Pald1 G T 10: 61,343,153 A489E probably benign Het
Pcnx G T 12: 81,918,204 G382W probably damaging Het
Pde6b T A 5: 108,419,726 M294K possibly damaging Het
Phf20 T C 2: 156,294,247 V662A probably benign Het
Plcg1 T C 2: 160,761,356 I1149T possibly damaging Het
Prdx2 T C 8: 84,970,567 S79P probably damaging Het
Rab19 T C 6: 39,383,921 M1T probably null Het
Retn T G 8: 3,656,908 F44C probably damaging Het
Rp1 A T 1: 4,243,618 W507R unknown Het
Rsf1 A C 7: 97,664,558 probably null Het
Ryr3 C T 2: 112,670,666 E3561K possibly damaging Het
Scaf1 T A 7: 45,003,292 Y1220F unknown Het
Sowahc A G 10: 59,222,669 K209R probably benign Het
Supt20 T A 3: 54,703,083 I103N probably damaging Het
Tenm4 A G 7: 96,896,160 E2498G probably benign Het
Tet1 T C 10: 62,839,156 N1047S probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tldc1 A T 8: 119,768,342 S226T probably benign Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Uggt1 T C 1: 36,184,426 E594G probably benign Het
Zcchc4 T C 5: 52,796,622 S215P probably benign Het
Zfc3h1 T G 10: 115,414,011 S1177A possibly damaging Het
Zfp646 G A 7: 127,881,878 A1076T probably damaging Het
Zfp735 T A 11: 73,711,197 Y322* probably null Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20038239 missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20048096 missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20042793 missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20042896 missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20040668 missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20029925 missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20041794 nonsense probably null
IGL02305:Vmn2r104 APN 17 20042856 missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20042786 missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20042821 missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20029604 missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20041813 missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20029807 missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20029627 missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20048002 nonsense probably null
R0709:Vmn2r104 UTSW 17 20042904 missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20042725 missense probably benign
R1575:Vmn2r104 UTSW 17 20042215 missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20042235 missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20040769 missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20042051 missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20048193 missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20029556 missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20029921 missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20029885 missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20042241 missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20048181 missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20040768 nonsense probably null
R4911:Vmn2r104 UTSW 17 20030026 missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20038266 missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20041884 missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20029901 missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20030188 missense probably damaging 0.97
R5461:Vmn2r104 UTSW 17 20030081 missense probably damaging 1.00
R5683:Vmn2r104 UTSW 17 20040719 nonsense probably null
R5795:Vmn2r104 UTSW 17 20030110 missense probably benign 0.02
R5795:Vmn2r104 UTSW 17 20030282 missense possibly damaging 0.89
R5970:Vmn2r104 UTSW 17 20029471 missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20041708 missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20029485 missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20038311 missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20041647 missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20030245 missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20041567 missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20029586 missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20042225 missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20030096 missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20040826 missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20029475 missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20029529 missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20041709 missense possibly damaging 0.48
R7958:Vmn2r104 UTSW 17 20042726 missense probably benign
R8031:Vmn2r104 UTSW 17 20042786 missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20030221 missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20030203 missense possibly damaging 0.89
R8308:Vmn2r104 UTSW 17 20040778 missense possibly damaging 0.55
R8691:Vmn2r104 UTSW 17 20041848 missense probably damaging 0.98
R8795:Vmn2r104 UTSW 17 20042726 missense probably benign
R8900:Vmn2r104 UTSW 17 20041662 missense probably damaging 0.99
R8913:Vmn2r104 UTSW 17 20029706 missense probably damaging 1.00
R9180:Vmn2r104 UTSW 17 20042825 missense probably benign 0.00
R9199:Vmn2r104 UTSW 17 20041835 missense probably damaging 0.99
R9282:Vmn2r104 UTSW 17 20040836 missense probably damaging 1.00
R9303:Vmn2r104 UTSW 17 20048177 missense possibly damaging 0.90
R9305:Vmn2r104 UTSW 17 20048177 missense possibly damaging 0.90
R9322:Vmn2r104 UTSW 17 20042825 missense probably benign 0.00
R9325:Vmn2r104 UTSW 17 20048171 missense possibly damaging 0.95
RF007:Vmn2r104 UTSW 17 20048040 missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20029789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGCTGAGCCCTTGTTGC -3'
(R):5'- AGACACTCCTATTGTCAAGGCC -3'

Sequencing Primer
(F):5'- CTGAGCCCTTGTTGCACAAAAGG -3'
(R):5'- CTCCTATTGTCAAGGCCAATAATCGG -3'
Posted On 2022-05-16