Incidental Mutation 'R9415:Anapc1'
ID 711982
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms 2610021O03Rik, tsg24, Apc1, Mcpr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9415 (G1)
Quality Score 203.009
Status Not validated
Chromosome 2
Chromosomal Location 128610104-128687391 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128634678 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 1340 (M1340T)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499]
AlphaFold P53995
Predicted Effect probably benign
Transcript: ENSMUST00000014499
AA Change: M1340T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: M1340T

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef15 A G 11: 68,951,407 L457P probably damaging Het
Arih2 A T 9: 108,609,787 C317S probably damaging Het
Asb14 A T 14: 26,911,836 T333S probably damaging Het
Atp13a4 T C 16: 29,409,003 N1012S Het
Capn9 C A 8: 124,605,710 D429E probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cntrob C T 11: 69,302,915 R803Q possibly damaging Het
Dnah8 A G 17: 30,810,323 I4089V probably benign Het
Fam162b A G 10: 51,590,059 probably null Het
Fhod3 A G 18: 24,969,187 D180G probably damaging Het
Gtf3c4 A G 2: 28,833,954 S589P possibly damaging Het
Jcad T C 18: 4,673,912 L558P probably damaging Het
Kmt2d A G 15: 98,839,705 I5170T unknown Het
Lamb3 T C 1: 193,326,011 F251L probably benign Het
Lpxn T A 19: 12,824,972 D220E probably benign Het
Mex3a T A 3: 88,537,173 F519I probably damaging Het
Mfap1a T C 2: 121,506,520 M8V probably benign Het
Mical3 T A 6: 120,957,751 D1789V probably damaging Het
Mpdz G A 4: 81,317,668 Q1211* probably null Het
Myd88 A G 9: 119,338,004 probably null Het
Myof T A 19: 37,952,964 K799N probably damaging Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Ntn4 A G 10: 93,644,626 T71A probably benign Het
Olfr392 A G 11: 73,814,317 I255T probably damaging Het
Olfr512 T A 7: 108,713,835 W161R probably damaging Het
Olfr683 T G 7: 105,144,291 M7L probably benign Het
Olfr863-ps1 A G 9: 19,941,904 W179R probably benign Het
Omd A C 13: 49,592,361 M416L probably benign Het
Oog1 G C 12: 87,608,316 L411F probably damaging Het
Pde4dip T C 3: 97,753,152 Q670R possibly damaging Het
Pex13 C A 11: 23,651,034 G272V probably damaging Het
Pfkl A T 10: 77,988,247 V769D probably damaging Het
Pkn3 A G 2: 30,078,320 Y10C probably benign Het
Pomgnt1 A G 4: 116,156,181 H500R probably damaging Het
Rasef T C 4: 73,727,645 T496A probably benign Het
Rgs6 A G 12: 83,137,392 S459G probably benign Het
Serpinb6b A T 13: 32,975,019 M187L Het
Shcbp1l A G 1: 153,445,881 I408M possibly damaging Het
Slc25a45 T C 19: 5,884,939 V272A probably damaging Het
Tlr4 T C 4: 66,827,923 probably null Het
Unc80 A T 1: 66,510,905 N774I Het
Urb2 T A 8: 124,029,874 S773R possibly damaging Het
Vmn1r35 A T 6: 66,679,131 V185E probably damaging Het
Vps13d A C 4: 145,069,957 V3691G Het
Wdtc1 A G 4: 133,295,373 V554A possibly damaging Het
Xrn1 A T 9: 95,969,474 M182L probably damaging Het
Zfp747 T C 7: 127,374,026 H324R possibly damaging Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 splice site probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
R8402:Anapc1 UTSW 2 128630228 missense probably benign 0.02
R8422:Anapc1 UTSW 2 128675837 missense probably benign
R8425:Anapc1 UTSW 2 128669868 missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128658344 splice site probably null
R8553:Anapc1 UTSW 2 128619913 missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128685828 missense probably benign 0.19
R8699:Anapc1 UTSW 2 128641453 missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128641449 missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128622413 missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128664032 missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128641402 missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128634708 missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128622506 missense possibly damaging 0.82
R9203:Anapc1 UTSW 2 128623502 missense possibly damaging 0.66
R9314:Anapc1 UTSW 2 128622500 missense possibly damaging 0.69
R9386:Anapc1 UTSW 2 128617722 missense probably benign 0.08
R9436:Anapc1 UTSW 2 128676125 missense probably benign
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATCATAGCCAACGCCAGAGTAG -3'
(R):5'- AGGCTCTTCTGAATTGTGTCC -3'

Sequencing Primer
(F):5'- GGACAAGTCACATCCACGTTTATGG -3'
(R):5'- AATTGTGTCCCTTTGTTTATCATGAG -3'
Posted On 2022-05-16