Incidental Mutation 'R9415:Cntrob'
ID 712008
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R9415 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 69193741 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 803 (R803Q)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176] [ENSMUST00000130780]
AlphaFold Q8CB62
Predicted Effect possibly damaging
Transcript: ENSMUST00000092973
AA Change: R803Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: R803Q

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000130780
SMART Domains Protein: ENSMUSP00000134842
Gene: ENSMUSG00000032782

DomainStartEndE-ValueType
low complexity region 50 64 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 A G 2: 128,476,598 (GRCm39) M1340T probably benign Het
Arhgef15 A G 11: 68,842,233 (GRCm39) L457P probably damaging Het
Arih2 A T 9: 108,486,986 (GRCm39) C317S probably damaging Het
Asb14 A T 14: 26,633,793 (GRCm39) T333S probably damaging Het
Atp13a4 T C 16: 29,227,821 (GRCm39) N1012S Het
Capn9 C A 8: 125,332,449 (GRCm39) D429E probably benign Het
Celsr1 G T 15: 85,917,286 (GRCm39) S229* probably null Het
Dnah8 A G 17: 31,029,297 (GRCm39) I4089V probably benign Het
Fam162b A G 10: 51,466,155 (GRCm39) probably null Het
Fhod3 A G 18: 25,102,244 (GRCm39) D180G probably damaging Het
Gtf3c4 A G 2: 28,723,966 (GRCm39) S589P possibly damaging Het
Jcad T C 18: 4,673,912 (GRCm39) L558P probably damaging Het
Kmt2d A G 15: 98,737,586 (GRCm39) I5170T unknown Het
Lamb3 T C 1: 193,008,319 (GRCm39) F251L probably benign Het
Lpxn T A 19: 12,802,336 (GRCm39) D220E probably benign Het
Mex3a T A 3: 88,444,480 (GRCm39) F519I probably damaging Het
Mfap1a T C 2: 121,337,001 (GRCm39) M8V probably benign Het
Mical3 T A 6: 120,934,712 (GRCm39) D1789V probably damaging Het
Mpdz G A 4: 81,235,905 (GRCm39) Q1211* probably null Het
Myd88 A G 9: 119,167,070 (GRCm39) probably null Het
Myof T A 19: 37,941,412 (GRCm39) K799N probably damaging Het
Naip2 T A 13: 100,298,243 (GRCm39) S598C probably damaging Het
Ndst4 C T 3: 125,518,385 (GRCm39) S354L probably benign Het
Ntn4 A G 10: 93,480,488 (GRCm39) T71A probably benign Het
Omd A C 13: 49,745,837 (GRCm39) M416L probably benign Het
Oog1 G C 12: 87,655,086 (GRCm39) L411F probably damaging Het
Or10a3m T A 7: 108,313,042 (GRCm39) W161R probably damaging Het
Or1e32 A G 11: 73,705,143 (GRCm39) I255T probably damaging Het
Or56a5 T G 7: 104,793,498 (GRCm39) M7L probably benign Het
Or7e171-ps1 A G 9: 19,853,200 (GRCm39) W179R probably benign Het
Pde4dip T C 3: 97,660,468 (GRCm39) Q670R possibly damaging Het
Pex13 C A 11: 23,601,034 (GRCm39) G272V probably damaging Het
Pfkl A T 10: 77,824,081 (GRCm39) V769D probably damaging Het
Pkn3 A G 2: 29,968,332 (GRCm39) Y10C probably benign Het
Pomgnt1 A G 4: 116,013,378 (GRCm39) H500R probably damaging Het
Rasef T C 4: 73,645,882 (GRCm39) T496A probably benign Het
Rgs6 A G 12: 83,184,166 (GRCm39) S459G probably benign Het
Serpinb6b A T 13: 33,159,002 (GRCm39) M187L Het
Shcbp1l A G 1: 153,321,627 (GRCm39) I408M possibly damaging Het
Slc25a45 T C 19: 5,934,967 (GRCm39) V272A probably damaging Het
Tlr4 T C 4: 66,746,160 (GRCm39) probably null Het
Unc80 A T 1: 66,550,064 (GRCm39) N774I Het
Urb2 T A 8: 124,756,613 (GRCm39) S773R possibly damaging Het
Vmn1r35 A T 6: 66,656,115 (GRCm39) V185E probably damaging Het
Vps13d A C 4: 144,796,527 (GRCm39) V3691G Het
Wdtc1 A G 4: 133,022,684 (GRCm39) V554A possibly damaging Het
Xrn1 A T 9: 95,851,527 (GRCm39) M182L probably damaging Het
Zfp747 T C 7: 126,973,198 (GRCm39) H324R possibly damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGGGGAAACTGTGACTCTAC -3'
(R):5'- TTGCAAGGCAGTGGTCTCAG -3'

Sequencing Primer
(F):5'- GGGGAAACTGTGACTCTACATTTC -3'
(R):5'- AAGGCAGTGGTCTCAGCACTG -3'
Posted On 2022-05-16