Incidental Mutation 'R9415:Serpinb6b'
ID 712012
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R9415 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32975019 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 187 (M187L)
Ref Sequence ENSEMBL: ENSMUSP00000105922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably benign
Transcript: ENSMUST00000017184
AA Change: M187L

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842
AA Change: M187L

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: M187L

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164541
AA Change: M68L

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 A G 2: 128,634,678 M1340T probably benign Het
Arhgef15 A G 11: 68,951,407 L457P probably damaging Het
Arih2 A T 9: 108,609,787 C317S probably damaging Het
Asb14 A T 14: 26,911,836 T333S probably damaging Het
Atp13a4 T C 16: 29,409,003 N1012S Het
Capn9 C A 8: 124,605,710 D429E probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cntrob C T 11: 69,302,915 R803Q possibly damaging Het
Dnah8 A G 17: 30,810,323 I4089V probably benign Het
Fam162b A G 10: 51,590,059 probably null Het
Fhod3 A G 18: 24,969,187 D180G probably damaging Het
Gtf3c4 A G 2: 28,833,954 S589P possibly damaging Het
Jcad T C 18: 4,673,912 L558P probably damaging Het
Kmt2d A G 15: 98,839,705 I5170T unknown Het
Lamb3 T C 1: 193,326,011 F251L probably benign Het
Lpxn T A 19: 12,824,972 D220E probably benign Het
Mex3a T A 3: 88,537,173 F519I probably damaging Het
Mfap1a T C 2: 121,506,520 M8V probably benign Het
Mical3 T A 6: 120,957,751 D1789V probably damaging Het
Mpdz G A 4: 81,317,668 Q1211* probably null Het
Myd88 A G 9: 119,338,004 probably null Het
Myof T A 19: 37,952,964 K799N probably damaging Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Ntn4 A G 10: 93,644,626 T71A probably benign Het
Olfr392 A G 11: 73,814,317 I255T probably damaging Het
Olfr512 T A 7: 108,713,835 W161R probably damaging Het
Olfr683 T G 7: 105,144,291 M7L probably benign Het
Olfr863-ps1 A G 9: 19,941,904 W179R probably benign Het
Omd A C 13: 49,592,361 M416L probably benign Het
Oog1 G C 12: 87,608,316 L411F probably damaging Het
Pde4dip T C 3: 97,753,152 Q670R possibly damaging Het
Pex13 C A 11: 23,651,034 G272V probably damaging Het
Pfkl A T 10: 77,988,247 V769D probably damaging Het
Pkn3 A G 2: 30,078,320 Y10C probably benign Het
Pomgnt1 A G 4: 116,156,181 H500R probably damaging Het
Rasef T C 4: 73,727,645 T496A probably benign Het
Rgs6 A G 12: 83,137,392 S459G probably benign Het
Shcbp1l A G 1: 153,445,881 I408M possibly damaging Het
Slc25a45 T C 19: 5,884,939 V272A probably damaging Het
Tlr4 T C 4: 66,827,923 probably null Het
Unc80 A T 1: 66,510,905 N774I Het
Urb2 T A 8: 124,029,874 S773R possibly damaging Het
Vmn1r35 A T 6: 66,679,131 V185E probably damaging Het
Vps13d A C 4: 145,069,957 V3691G Het
Wdtc1 A G 4: 133,295,373 V554A possibly damaging Het
Xrn1 A T 9: 95,969,474 M182L probably damaging Het
Zfp747 T C 7: 127,374,026 H324R possibly damaging Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32972263 missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32977558 nonsense probably null
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32977576 missense probably benign 0.23
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32968607 missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32971596
R8814:Serpinb6b UTSW 13 32978304 missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 32978052 missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 32978142 missense probably benign 0.45
R9037:Serpinb6b UTSW 13 32978015 nonsense probably null
R9129:Serpinb6b UTSW 13 32978156 small deletion probably benign
R9377:Serpinb6b UTSW 13 32968511 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTGGCCCCTCTGCATAG -3'
(R):5'- AGCAAGCAGATATCCTATCAGTG -3'

Sequencing Primer
(F):5'- CATAGCAGCCTTGTGCATGTATCAG -3'
(R):5'- CAAGCAGATATCCTATCAGTGCTTTC -3'
Posted On 2022-05-16