Mutagenetix > Incidental Mutation

Incidental Mutation 'R9415:Kmt2d'

712017

Institutional Source

Beutler Lab

Gene Symbol

Kmt2d

Ensembl Gene

ENSMUSG00000048154

Gene Name

lysine (K)-specific methyltransferase 2D

Synonyms

Mll2, C430014K11Rik, Mll4

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9415 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98831669-98871204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98839705 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 5170 (I5170T)

Ref Sequence

ENSEMBL: ENSMUSP00000023741 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000023741
AA Change: I5170T

SMART Domains

Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: I5170T

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
PHD	171	218	1.65e-5	SMART
RING	172	217	2.01e0	SMART
PHD	228	274	2.13e-8	SMART
RING	229	273	2.11e-3	SMART
PHD	275	321	1.57e-11	SMART
RING	276	320	2.36e0	SMART
low complexity region	430	489	N/A	INTRINSIC
low complexity region	500	562	N/A	INTRINSIC
low complexity region	564	613	N/A	INTRINSIC
low complexity region	619	717	N/A	INTRINSIC
internal_repeat_3	719	768	2.82e-8	PROSPERO
internal_repeat_3	773	822	2.82e-8	PROSPERO
low complexity region	826	842	N/A	INTRINSIC
low complexity region	844	919	N/A	INTRINSIC
low complexity region	958	981	N/A	INTRINSIC
low complexity region	985	1023	N/A	INTRINSIC
low complexity region	1069	1076	N/A	INTRINSIC
low complexity region	1139	1153	N/A	INTRINSIC
low complexity region	1259	1285	N/A	INTRINSIC
low complexity region	1307	1314	N/A	INTRINSIC
PHD	1335	1384	7.01e-9	SMART
RING	1336	1383	1.46e1	SMART
PHD	1385	1431	8.56e-13	SMART
PHD	1462	1513	1.11e-6	SMART
RING	1463	1512	1.46e1	SMART
low complexity region	1514	1538	N/A	INTRINSIC
low complexity region	1567	1576	N/A	INTRINSIC
low complexity region	1589	1612	N/A	INTRINSIC
low complexity region	1634	1646	N/A	INTRINSIC
low complexity region	1707	1719	N/A	INTRINSIC
low complexity region	1883	1896	N/A	INTRINSIC
low complexity region	1931	1950	N/A	INTRINSIC
HMG	1969	2037	6.35e-6	SMART
low complexity region	2064	2079	N/A	INTRINSIC
low complexity region	2147	2167	N/A	INTRINSIC
low complexity region	2170	2181	N/A	INTRINSIC
low complexity region	2306	2323	N/A	INTRINSIC
low complexity region	2334	2359	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2402	2419	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2610	2622	N/A	INTRINSIC
coiled coil region	2632	2665	N/A	INTRINSIC
coiled coil region	2768	2813	N/A	INTRINSIC
low complexity region	2855	2868	N/A	INTRINSIC
low complexity region	2887	2899	N/A	INTRINSIC
low complexity region	3151	3165	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
low complexity region	3241	3263	N/A	INTRINSIC
low complexity region	3390	3400	N/A	INTRINSIC
low complexity region	3629	3659	N/A	INTRINSIC
coiled coil region	3712	3749	N/A	INTRINSIC
low complexity region	3781	3801	N/A	INTRINSIC
coiled coil region	3910	4003	N/A	INTRINSIC
low complexity region	4128	4159	N/A	INTRINSIC
low complexity region	4167	4183	N/A	INTRINSIC
low complexity region	4226	4246	N/A	INTRINSIC
low complexity region	4266	4293	N/A	INTRINSIC
low complexity region	4306	4322	N/A	INTRINSIC
low complexity region	4361	4378	N/A	INTRINSIC
coiled coil region	4591	4613	N/A	INTRINSIC
low complexity region	4661	4684	N/A	INTRINSIC
low complexity region	4745	4755	N/A	INTRINSIC
low complexity region	4877	4896	N/A	INTRINSIC
low complexity region	4957	4983	N/A	INTRINSIC
low complexity region	4989	5029	N/A	INTRINSIC
low complexity region	5100	5107	N/A	INTRINSIC
PHD	5142	5188	4.67e-5	SMART
RING	5143	5187	4.87e0	SMART
FYRN	5242	5285	5.07e-21	SMART
FYRC	5291	5378	2.51e-43	SMART
SET	5448	5570	5.69e-36	SMART
PostSET	5572	5588	3.58e-5	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000178486
AA Change: I5170T

SMART Domains

Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: I5170T

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
PHD	171	218	1.65e-5	SMART
RING	172	217	2.01e0	SMART
PHD	228	274	2.13e-8	SMART
RING	229	273	2.11e-3	SMART
PHD	275	321	1.57e-11	SMART
RING	276	320	2.36e0	SMART
low complexity region	430	489	N/A	INTRINSIC
low complexity region	500	562	N/A	INTRINSIC
low complexity region	564	613	N/A	INTRINSIC
low complexity region	619	717	N/A	INTRINSIC
internal_repeat_3	719	768	2.82e-8	PROSPERO
internal_repeat_3	773	822	2.82e-8	PROSPERO
low complexity region	826	842	N/A	INTRINSIC
low complexity region	844	919	N/A	INTRINSIC
low complexity region	958	981	N/A	INTRINSIC
low complexity region	985	1023	N/A	INTRINSIC
low complexity region	1069	1076	N/A	INTRINSIC
low complexity region	1139	1153	N/A	INTRINSIC
low complexity region	1259	1285	N/A	INTRINSIC
low complexity region	1307	1314	N/A	INTRINSIC
PHD	1335	1384	7.01e-9	SMART
RING	1336	1383	1.46e1	SMART
PHD	1385	1431	8.56e-13	SMART
PHD	1462	1513	1.11e-6	SMART
RING	1463	1512	1.46e1	SMART
low complexity region	1514	1538	N/A	INTRINSIC
low complexity region	1567	1576	N/A	INTRINSIC
low complexity region	1589	1612	N/A	INTRINSIC
low complexity region	1634	1646	N/A	INTRINSIC
low complexity region	1707	1719	N/A	INTRINSIC
low complexity region	1883	1896	N/A	INTRINSIC
low complexity region	1931	1950	N/A	INTRINSIC
HMG	1969	2037	6.35e-6	SMART
low complexity region	2064	2079	N/A	INTRINSIC
low complexity region	2147	2167	N/A	INTRINSIC
low complexity region	2170	2181	N/A	INTRINSIC
low complexity region	2306	2323	N/A	INTRINSIC
low complexity region	2334	2359	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2402	2419	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2610	2622	N/A	INTRINSIC
coiled coil region	2632	2665	N/A	INTRINSIC
coiled coil region	2768	2813	N/A	INTRINSIC
low complexity region	2855	2868	N/A	INTRINSIC
low complexity region	2887	2899	N/A	INTRINSIC
low complexity region	3151	3165	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
low complexity region	3241	3263	N/A	INTRINSIC
low complexity region	3390	3400	N/A	INTRINSIC
low complexity region	3629	3659	N/A	INTRINSIC
coiled coil region	3712	3749	N/A	INTRINSIC
low complexity region	3781	3801	N/A	INTRINSIC
coiled coil region	3910	4003	N/A	INTRINSIC
low complexity region	4128	4159	N/A	INTRINSIC
low complexity region	4167	4183	N/A	INTRINSIC
low complexity region	4226	4246	N/A	INTRINSIC
low complexity region	4266	4293	N/A	INTRINSIC
low complexity region	4306	4322	N/A	INTRINSIC
low complexity region	4361	4378	N/A	INTRINSIC
coiled coil region	4591	4613	N/A	INTRINSIC
low complexity region	4661	4684	N/A	INTRINSIC
low complexity region	4745	4755	N/A	INTRINSIC
low complexity region	4877	4896	N/A	INTRINSIC
low complexity region	4957	4983	N/A	INTRINSIC
low complexity region	4989	5029	N/A	INTRINSIC
low complexity region	5100	5107	N/A	INTRINSIC
PHD	5142	5188	4.67e-5	SMART
RING	5143	5187	4.87e0	SMART
FYRN	5242	5285	5.07e-21	SMART
FYRC	5291	5378	2.51e-43	SMART
SET	5448	5570	5.69e-36	SMART
PostSET	5572	5588	3.58e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191973

SMART Domains

Protein: ENSMUSP00000142312
Gene: ENSMUSG00000048154

Domain	Start	End	E-Value	Type
SET	78	200	5.69e-36	SMART
PostSET	202	218	3.58e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc1	A	G	2: 128,634,678	M1340T	probably benign	Het
Arhgef15	A	G	11: 68,951,407	L457P	probably damaging	Het
Arih2	A	T	9: 108,609,787	C317S	probably damaging	Het
Asb14	A	T	14: 26,911,836	T333S	probably damaging	Het
Atp13a4	T	C	16: 29,409,003	N1012S		Het
Capn9	C	A	8: 124,605,710	D429E	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Cntrob	C	T	11: 69,302,915	R803Q	possibly damaging	Het
Dnah8	A	G	17: 30,810,323	I4089V	probably benign	Het
Fam162b	A	G	10: 51,590,059		probably null	Het
Fhod3	A	G	18: 24,969,187	D180G	probably damaging	Het
Gtf3c4	A	G	2: 28,833,954	S589P	possibly damaging	Het
Jcad	T	C	18: 4,673,912	L558P	probably damaging	Het
Lamb3	T	C	1: 193,326,011	F251L	probably benign	Het
Lpxn	T	A	19: 12,824,972	D220E	probably benign	Het
Mex3a	T	A	3: 88,537,173	F519I	probably damaging	Het
Mfap1a	T	C	2: 121,506,520	M8V	probably benign	Het
Mical3	T	A	6: 120,957,751	D1789V	probably damaging	Het
Mpdz	G	A	4: 81,317,668	Q1211*	probably null	Het
Myd88	A	G	9: 119,338,004		probably null	Het
Myof	T	A	19: 37,952,964	K799N	probably damaging	Het
Naip2	T	A	13: 100,161,735	S598C	probably damaging	Het
Ndst4	C	T	3: 125,724,736	S354L	probably benign	Het
Ntn4	A	G	10: 93,644,626	T71A	probably benign	Het
Olfr392	A	G	11: 73,814,317	I255T	probably damaging	Het
Olfr512	T	A	7: 108,713,835	W161R	probably damaging	Het
Olfr683	T	G	7: 105,144,291	M7L	probably benign	Het
Olfr863-ps1	A	G	9: 19,941,904	W179R	probably benign	Het
Omd	A	C	13: 49,592,361	M416L	probably benign	Het
Oog1	G	C	12: 87,608,316	L411F	probably damaging	Het
Pde4dip	T	C	3: 97,753,152	Q670R	possibly damaging	Het
Pex13	C	A	11: 23,651,034	G272V	probably damaging	Het
Pfkl	A	T	10: 77,988,247	V769D	probably damaging	Het
Pkn3	A	G	2: 30,078,320	Y10C	probably benign	Het
Pomgnt1	A	G	4: 116,156,181	H500R	probably damaging	Het
Rasef	T	C	4: 73,727,645	T496A	probably benign	Het
Rgs6	A	G	12: 83,137,392	S459G	probably benign	Het
Serpinb6b	A	T	13: 32,975,019	M187L		Het
Shcbp1l	A	G	1: 153,445,881	I408M	possibly damaging	Het
Slc25a45	T	C	19: 5,884,939	V272A	probably damaging	Het
Tlr4	T	C	4: 66,827,923		probably null	Het
Unc80	A	T	1: 66,510,905	N774I		Het
Urb2	T	A	8: 124,029,874	S773R	possibly damaging	Het
Vmn1r35	A	T	6: 66,679,131	V185E	probably damaging	Het
Vps13d	A	C	4: 145,069,957	V3691G		Het
Wdtc1	A	G	4: 133,295,373	V554A	possibly damaging	Het
Xrn1	A	T	9: 95,969,474	M182L	probably damaging	Het
Zfp747	T	C	7: 127,374,026	H324R	possibly damaging	Het

Other mutations in Kmt2d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Kmt2d	APN	15	98862333	missense	unknown
IGL00927:Kmt2d	APN	15	98845009	unclassified	probably benign
IGL01123:Kmt2d	APN	15	98837148	missense	unknown
IGL01288:Kmt2d	APN	15	98865044	missense	probably damaging	1.00
IGL01538:Kmt2d	APN	15	98860657	unclassified	probably benign
IGL01575:Kmt2d	APN	15	98846855	utr 3 prime	probably benign
IGL01584:Kmt2d	APN	15	98856369	unclassified	probably benign
IGL01750:Kmt2d	APN	15	98853168	unclassified	probably benign
IGL02163:Kmt2d	APN	15	98835228	unclassified	probably benign
IGL02209:Kmt2d	APN	15	98854567	unclassified	probably benign
IGL02253:Kmt2d	APN	15	98858175	unclassified	probably benign
IGL02271:Kmt2d	APN	15	98866428	missense	possibly damaging	0.89
IGL02291:Kmt2d	APN	15	98865492	splice site	probably benign
IGL02448:Kmt2d	APN	15	98844110	unclassified	probably benign
IGL02472:Kmt2d	APN	15	98850077	missense	probably benign	0.23
IGL02496:Kmt2d	APN	15	98857558	unclassified	probably benign
IGL02527:Kmt2d	APN	15	98841747	unclassified	probably benign
IGL02576:Kmt2d	APN	15	98864120	missense	unknown
IGL02597:Kmt2d	APN	15	98863831	missense	unknown
IGL02609:Kmt2d	APN	15	98851793	unclassified	probably benign
IGL03085:Kmt2d	APN	15	98839940	unclassified	probably benign
IGL03102:Kmt2d	APN	15	98855543	missense	probably benign
IGL03123:Kmt2d	APN	15	98861771	missense	unknown
G1citation:Kmt2d	UTSW	15	98849459	unclassified	probably benign
R0091:Kmt2d	UTSW	15	98844479	unclassified	probably benign
R0136:Kmt2d	UTSW	15	98854278	unclassified	probably benign
R0243:Kmt2d	UTSW	15	98850137	unclassified	probably benign
R0276:Kmt2d	UTSW	15	98850311	unclassified	probably benign
R0477:Kmt2d	UTSW	15	98853581	unclassified	probably benign
R0478:Kmt2d	UTSW	15	98853581	unclassified	probably benign
R0586:Kmt2d	UTSW	15	98835207	unclassified	probably benign
R0632:Kmt2d	UTSW	15	98853581	unclassified	probably benign
R0678:Kmt2d	UTSW	15	98850413	unclassified	probably benign
R0780:Kmt2d	UTSW	15	98862857	missense	unknown
R0891:Kmt2d	UTSW	15	98852691	unclassified	probably benign
R1136:Kmt2d	UTSW	15	98857765	unclassified	probably benign
R1417:Kmt2d	UTSW	15	98866430	missense	probably damaging	0.99
R1499:Kmt2d	UTSW	15	98844938	unclassified	probably benign
R1510:Kmt2d	UTSW	15	98856377	unclassified	probably benign
R1586:Kmt2d	UTSW	15	98865053	splice site	probably benign
R1640:Kmt2d	UTSW	15	98845057	unclassified	probably benign
R1714:Kmt2d	UTSW	15	98862950	missense	unknown
R1725:Kmt2d	UTSW	15	98845234	unclassified	probably benign
R1728:Kmt2d	UTSW	15	98865132	missense	probably damaging	1.00
R1729:Kmt2d	UTSW	15	98865132	missense	probably damaging	1.00
R1741:Kmt2d	UTSW	15	98845234	unclassified	probably benign
R1744:Kmt2d	UTSW	15	98865047	missense	probably damaging	0.99
R1746:Kmt2d	UTSW	15	98864378	missense	probably damaging	0.97
R1753:Kmt2d	UTSW	15	98843482	unclassified	probably benign
R1782:Kmt2d	UTSW	15	98857548	unclassified	probably benign
R1789:Kmt2d	UTSW	15	98852074	unclassified	probably benign
R1802:Kmt2d	UTSW	15	98862985	missense	unknown
R1808:Kmt2d	UTSW	15	98866686	missense	probably damaging	1.00
R1822:Kmt2d	UTSW	15	98861780	missense	unknown
R1831:Kmt2d	UTSW	15	98855343	missense	probably damaging	0.97
R1920:Kmt2d	UTSW	15	98855590	missense	probably damaging	0.96
R1920:Kmt2d	UTSW	15	98855591	missense	probably damaging	1.00
R1956:Kmt2d	UTSW	15	98859590	unclassified	probably benign
R2100:Kmt2d	UTSW	15	98846480	unclassified	probably benign
R2120:Kmt2d	UTSW	15	98839529	unclassified	probably benign
R2188:Kmt2d	UTSW	15	98839300	unclassified	probably benign
R2191:Kmt2d	UTSW	15	98861049	critical splice donor site	probably null
R2234:Kmt2d	UTSW	15	98865248	missense	probably damaging	0.98
R2422:Kmt2d	UTSW	15	98862266	missense	unknown
R2762:Kmt2d	UTSW	15	98852055	unclassified	probably benign
R2895:Kmt2d	UTSW	15	98843939	unclassified	probably benign
R3624:Kmt2d	UTSW	15	98842902	unclassified	probably benign
R3791:Kmt2d	UTSW	15	98844149	unclassified	probably benign
R3794:Kmt2d	UTSW	15	98837359	unclassified	probably benign
R3871:Kmt2d	UTSW	15	98851021	unclassified	probably benign
R3958:Kmt2d	UTSW	15	98855549	missense	possibly damaging	0.69
R3983:Kmt2d	UTSW	15	98846046	unclassified	probably benign
R4211:Kmt2d	UTSW	15	98840189	unclassified	probably benign
R4212:Kmt2d	UTSW	15	98845003	unclassified	probably benign
R4240:Kmt2d	UTSW	15	98844571	unclassified	probably benign
R4246:Kmt2d	UTSW	15	98840089	unclassified	probably benign
R4361:Kmt2d	UTSW	15	98863670	missense	unknown
R4388:Kmt2d	UTSW	15	98853626	unclassified	probably benign
R4602:Kmt2d	UTSW	15	98850259	unclassified	probably benign
R4606:Kmt2d	UTSW	15	98839716	unclassified	probably benign
R4658:Kmt2d	UTSW	15	98852529	unclassified	probably benign
R4840:Kmt2d	UTSW	15	98861894	missense	unknown
R4895:Kmt2d	UTSW	15	98844487	unclassified	probably benign
R4906:Kmt2d	UTSW	15	98849539	unclassified	probably benign
R4976:Kmt2d	UTSW	15	98847194	utr 3 prime	probably benign
R5093:Kmt2d	UTSW	15	98856162	missense	probably damaging	1.00
R5119:Kmt2d	UTSW	15	98847194	utr 3 prime	probably benign
R5160:Kmt2d	UTSW	15	98840224	unclassified	probably benign
R5260:Kmt2d	UTSW	15	98842860	unclassified	probably benign
R5274:Kmt2d	UTSW	15	98854230	unclassified	probably benign
R5450:Kmt2d	UTSW	15	98855086	missense	probably damaging	1.00
R5461:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5462:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5463:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5465:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5467:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5481:Kmt2d	UTSW	15	98862005	missense	unknown
R5509:Kmt2d	UTSW	15	98839676	unclassified	probably benign
R5534:Kmt2d	UTSW	15	98837357	unclassified	probably benign
R5536:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5537:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5538:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5546:Kmt2d	UTSW	15	98853068	unclassified	probably benign
R5595:Kmt2d	UTSW	15	98850024	unclassified	probably benign
R5645:Kmt2d	UTSW	15	98844397	unclassified	probably benign
R5679:Kmt2d	UTSW	15	98854272	unclassified	probably benign
R5710:Kmt2d	UTSW	15	98854106	unclassified	probably benign
R5755:Kmt2d	UTSW	15	98863646	missense	unknown
R5817:Kmt2d	UTSW	15	98862363	missense	unknown
R5841:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5842:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5843:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5844:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5845:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R6122:Kmt2d	UTSW	15	98860692	unclassified	probably benign
R6612:Kmt2d	UTSW	15	98845858	unclassified	probably benign
R6718:Kmt2d	UTSW	15	98849586	unclassified	probably benign
R6718:Kmt2d	UTSW	15	98850539	unclassified	probably benign
R6822:Kmt2d	UTSW	15	98849459	unclassified	probably benign
R6866:Kmt2d	UTSW	15	98857393	unclassified	probably benign
R6950:Kmt2d	UTSW	15	98840020	unclassified	probably benign
R7089:Kmt2d	UTSW	15	98850272	missense	unknown
R7120:Kmt2d	UTSW	15	98861065	missense	unknown
R7131:Kmt2d	UTSW	15	98849616	unclassified	probably benign
R7177:Kmt2d	UTSW	15	98850386	missense	unknown
R7194:Kmt2d	UTSW	15	98843833	missense	unknown
R7252:Kmt2d	UTSW	15	98844266	missense	unknown
R7282:Kmt2d	UTSW	15	98854104	missense	unknown
R7307:Kmt2d	UTSW	15	98849418	missense	unknown
R7313:Kmt2d	UTSW	15	98856623	missense	unknown
R7394:Kmt2d	UTSW	15	98856384	missense	unknown
R7404:Kmt2d	UTSW	15	98845495	missense	unknown
R7409:Kmt2d	UTSW	15	98855354	missense	probably damaging	1.00
R7414:Kmt2d	UTSW	15	98839856	missense	unknown
R7534:Kmt2d	UTSW	15	98852018	missense	unknown
R7575:Kmt2d	UTSW	15	98849611	unclassified	probably benign
R7650:Kmt2d	UTSW	15	98850870	missense	unknown
R7687:Kmt2d	UTSW	15	98862120	missense	unknown
R7699:Kmt2d	UTSW	15	98843719	missense	unknown
R7700:Kmt2d	UTSW	15	98843719	missense	unknown
R7765:Kmt2d	UTSW	15	98852334	missense	unknown
R7797:Kmt2d	UTSW	15	98864406	missense	probably benign	0.24
R7803:Kmt2d	UTSW	15	98862923	missense	unknown
R7952:Kmt2d	UTSW	15	98850768	missense	unknown
R8054:Kmt2d	UTSW	15	98843925	missense	unknown
R8084:Kmt2d	UTSW	15	98842064	missense	unknown
R8089:Kmt2d	UTSW	15	98842869	missense	unknown
R8133:Kmt2d	UTSW	15	98864942	missense	probably damaging	1.00
R8138:Kmt2d	UTSW	15	98843653	missense	unknown
R8343:Kmt2d	UTSW	15	98852597	missense	unknown
R8681:Kmt2d	UTSW	15	98846067	missense	unknown
R8694:Kmt2d	UTSW	15	98844734	missense	unknown
R8837:Kmt2d	UTSW	15	98864167	missense	unknown
R8855:Kmt2d	UTSW	15	98856356	missense	unknown
R8934:Kmt2d	UTSW	15	98861886	missense	unknown
R9100:Kmt2d	UTSW	15	98849951	missense	unknown
R9158:Kmt2d	UTSW	15	98843139	missense	unknown
R9190:Kmt2d	UTSW	15	98852015	missense	unknown
R9222:Kmt2d	UTSW	15	98849443	missense	unknown
R9263:Kmt2d	UTSW	15	98849618	frame shift	probably null
R9336:Kmt2d	UTSW	15	98845816	missense	unknown
R9397:Kmt2d	UTSW	15	98850113	missense	unknown
R9482:Kmt2d	UTSW	15	98865165	missense	probably damaging	1.00
R9529:Kmt2d	UTSW	15	98839768	missense	unknown
R9610:Kmt2d	UTSW	15	98845176	unclassified	probably benign
R9611:Kmt2d	UTSW	15	98845173	unclassified	probably benign
R9611:Kmt2d	UTSW	15	98845176	unclassified	probably benign
R9612:Kmt2d	UTSW	15	98845176	unclassified	probably benign
R9613:Kmt2d	UTSW	15	98845176	unclassified	probably benign
R9644:Kmt2d	UTSW	15	98845504	missense	unknown
R9716:Kmt2d	UTSW	15	98843402	missense	unknown
R9763:Kmt2d	UTSW	15	98845176	unclassified	probably benign
R9782:Kmt2d	UTSW	15	98866716	missense	probably damaging	1.00
X0018:Kmt2d	UTSW	15	98852922	unclassified	probably benign
X0024:Kmt2d	UTSW	15	98853053	unclassified	probably benign
X0062:Kmt2d	UTSW	15	98849819	unclassified	probably benign
Z1187:Kmt2d	UTSW	15	98851744	missense	unknown
Z1188:Kmt2d	UTSW	15	98851744	missense	unknown
Z1189:Kmt2d	UTSW	15	98851744	missense	unknown
Z1190:Kmt2d	UTSW	15	98851744	missense	unknown
Z1192:Kmt2d	UTSW	15	98851744	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AAGGCCTCCTACTCGGAACATG -3'
(R):5'- TGCTCAACCTCGACTTGGAC -3'

Sequencing Primer
(F):5'- TACTCGGAACATGTGTAGCC -3'
(R):5'- TGGGTACACCTCAACTGTGC -3'

Posted On

2022-05-16