Incidental Mutation 'R9415:Atp13a4'
ID 712018
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 9330174J19Rik, 4631413J11Rik
Accession Numbers

Genbank: NM_001164612, NM_172613, NM_001164613

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9415 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 29395853-29544864 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29409003 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1012 (N1012S)
Ref Sequence ENSEMBL: ENSMUSP00000060987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: N1012S

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182573
Predicted Effect probably benign
Transcript: ENSMUST00000182627
AA Change: N1031S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: N1031S

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 A G 2: 128,634,678 M1340T probably benign Het
Arhgef15 A G 11: 68,951,407 L457P probably damaging Het
Arih2 A T 9: 108,609,787 C317S probably damaging Het
Asb14 A T 14: 26,911,836 T333S probably damaging Het
Capn9 C A 8: 124,605,710 D429E probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cntrob C T 11: 69,302,915 R803Q possibly damaging Het
Dnah8 A G 17: 30,810,323 I4089V probably benign Het
Fam162b A G 10: 51,590,059 probably null Het
Fhod3 A G 18: 24,969,187 D180G probably damaging Het
Gtf3c4 A G 2: 28,833,954 S589P possibly damaging Het
Jcad T C 18: 4,673,912 L558P probably damaging Het
Kmt2d A G 15: 98,839,705 I5170T unknown Het
Lamb3 T C 1: 193,326,011 F251L probably benign Het
Lpxn T A 19: 12,824,972 D220E probably benign Het
Mex3a T A 3: 88,537,173 F519I probably damaging Het
Mfap1a T C 2: 121,506,520 M8V probably benign Het
Mical3 T A 6: 120,957,751 D1789V probably damaging Het
Mpdz G A 4: 81,317,668 Q1211* probably null Het
Myd88 A G 9: 119,338,004 probably null Het
Myof T A 19: 37,952,964 K799N probably damaging Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Ntn4 A G 10: 93,644,626 T71A probably benign Het
Olfr392 A G 11: 73,814,317 I255T probably damaging Het
Olfr512 T A 7: 108,713,835 W161R probably damaging Het
Olfr683 T G 7: 105,144,291 M7L probably benign Het
Olfr863-ps1 A G 9: 19,941,904 W179R probably benign Het
Omd A C 13: 49,592,361 M416L probably benign Het
Oog1 G C 12: 87,608,316 L411F probably damaging Het
Pde4dip T C 3: 97,753,152 Q670R possibly damaging Het
Pex13 C A 11: 23,651,034 G272V probably damaging Het
Pfkl A T 10: 77,988,247 V769D probably damaging Het
Pkn3 A G 2: 30,078,320 Y10C probably benign Het
Pomgnt1 A G 4: 116,156,181 H500R probably damaging Het
Rasef T C 4: 73,727,645 T496A probably benign Het
Rgs6 A G 12: 83,137,392 S459G probably benign Het
Serpinb6b A T 13: 32,975,019 M187L Het
Shcbp1l A G 1: 153,445,881 I408M possibly damaging Het
Slc25a45 T C 19: 5,884,939 V272A probably damaging Het
Tlr4 T C 4: 66,827,923 probably null Het
Unc80 A T 1: 66,510,905 N774I Het
Urb2 T A 8: 124,029,874 S773R possibly damaging Het
Vmn1r35 A T 6: 66,679,131 V185E probably damaging Het
Vps13d A C 4: 145,069,957 V3691G Het
Wdtc1 A G 4: 133,295,373 V554A possibly damaging Het
Xrn1 A T 9: 95,969,474 M182L probably damaging Het
Zfp747 T C 7: 127,374,026 H324R possibly damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29403778 splice site probably benign
IGL01577:Atp13a4 APN 16 29441284 missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29415777 splice site probably benign
IGL02165:Atp13a4 APN 16 29434010 missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29456629 missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29440102 missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29422703 missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29441307 missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29456671 missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29455488 missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29455395 missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29421724 missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29454834 missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29471953 missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29420428 missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29409710 missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29408928 missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29456611 missense probably damaging 0.99
R1967:Atp13a4 UTSW 16 29479854 missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29422684 missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29441284 missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29413749 missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29418571 missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29541250 missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29452603 missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29420835 intron probably benign
R4795:Atp13a4 UTSW 16 29490008 critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29408961 nonsense probably null
R4996:Atp13a4 UTSW 16 29472004 missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29409868 missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29456610 missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29420888 nonsense probably null
R5395:Atp13a4 UTSW 16 29456604 missense possibly damaging 0.94
R5640:Atp13a4 UTSW 16 29415831 missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29433987 missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29456571 missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29434004 missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29471901 nonsense probably null
R6497:Atp13a4 UTSW 16 29479901 missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29479841 missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29469280 missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29420905 missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29441196 missense
R7493:Atp13a4 UTSW 16 29471956 missense
R7712:Atp13a4 UTSW 16 29459487 missense
R7739:Atp13a4 UTSW 16 29456601 missense
R7897:Atp13a4 UTSW 16 29396466 missense
R7950:Atp13a4 UTSW 16 29449917 missense
R8217:Atp13a4 UTSW 16 29403801 missense
R8227:Atp13a4 UTSW 16 29403845 missense
R8273:Atp13a4 UTSW 16 29471902 missense
R8488:Atp13a4 UTSW 16 29417836 missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29454769 nonsense probably null
R8773:Atp13a4 UTSW 16 29441580 missense
R8921:Atp13a4 UTSW 16 29454774 missense
R8940:Atp13a4 UTSW 16 29454690 critical splice donor site probably null
R9056:Atp13a4 UTSW 16 29471888 critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29449979 missense
R9292:Atp13a4 UTSW 16 29422682 missense
R9453:Atp13a4 UTSW 16 29420841 missense unknown
R9497:Atp13a4 UTSW 16 29469312 critical splice acceptor site probably null
R9541:Atp13a4 UTSW 16 29422726 missense
R9614:Atp13a4 UTSW 16 29441580 missense
R9622:Atp13a4 UTSW 16 29420459 missense
Z1176:Atp13a4 UTSW 16 29422587 missense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGCTCTAATGATCAGCAATGG -3'
(R):5'- ATGGTGGATGAACAGCTTAATGAAC -3'

Sequencing Primer
(F):5'- GCAATGGTTAATAATCGTCCCTCTG -3'
(R):5'- TGAACAGCTTAATGAACAAGTAGC -3'
Posted On 2022-05-16