Incidental Mutation 'R9415:Myof'
ID 712024
Institutional Source Beutler Lab
Gene Symbol Myof
Ensembl Gene ENSMUSG00000048612
Gene Name myoferlin
Synonyms Fer1l3, E030042N20Rik, 2310051D19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9415 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 37899036-38043577 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37952964 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 799 (K799N)
Ref Sequence ENSEMBL: ENSMUSP00000045036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041475] [ENSMUST00000172095] [ENSMUST00000225159] [ENSMUST00000226068]
AlphaFold Q69ZN7
Predicted Effect probably damaging
Transcript: ENSMUST00000041475
AA Change: K799N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045036
Gene: ENSMUSG00000048612
AA Change: K799N

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1425 1436 N/A INTRINSIC
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
Pfam:Ferlin_C 1939 2043 2.4e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172095
AA Change: K799N

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129792
Gene: ENSMUSG00000048612
AA Change: K799N

DomainStartEndE-ValueType
C2 1 100 7.56e-16 SMART
low complexity region 142 159 N/A INTRINSIC
C2 200 299 4.03e-11 SMART
FerI 282 353 2.76e-37 SMART
C2 359 473 2.93e-13 SMART
low complexity region 532 543 N/A INTRINSIC
FerA 663 728 5.07e-27 SMART
FerB 755 829 2.39e-46 SMART
DysFN 843 901 6.42e-21 SMART
DysFN 914 970 1.16e-18 SMART
DysFC 979 1017 1.04e-11 SMART
DysFC 1037 1070 1.62e-8 SMART
C2 1127 1234 5.03e-12 SMART
C2 1289 1396 1.15e1 SMART
low complexity region 1515 1526 N/A INTRINSIC
C2 1541 1640 2.66e-11 SMART
C2 1776 1905 2.81e-1 SMART
transmembrane domain 2013 2035 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225159
AA Change: K283N

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226068
AA Change: K812N

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the ferlin family of proteins, which have been implicated in fusion events in muscle tissue. Members of this family have a carboxy-terminal single pass transmembrane domain and multiple C2 domains, which bind negatively charged phospholipids in the presence of calcium ions. This gene is expressed at high levels in myoblasts and upregulated in damaged skeletal muscle. Mice deficient in this protein display defects in myoblast fusion, muscle regeneration, and angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, impaired myogenesis, lack of large diameter myofibers, abnormal skeletal muscle regeneration after injury, and decreased vascular permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 A G 2: 128,634,678 M1340T probably benign Het
Arhgef15 A G 11: 68,951,407 L457P probably damaging Het
Arih2 A T 9: 108,609,787 C317S probably damaging Het
Asb14 A T 14: 26,911,836 T333S probably damaging Het
Atp13a4 T C 16: 29,409,003 N1012S Het
Capn9 C A 8: 124,605,710 D429E probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Cntrob C T 11: 69,302,915 R803Q possibly damaging Het
Dnah8 A G 17: 30,810,323 I4089V probably benign Het
Fam162b A G 10: 51,590,059 probably null Het
Fhod3 A G 18: 24,969,187 D180G probably damaging Het
Gtf3c4 A G 2: 28,833,954 S589P possibly damaging Het
Jcad T C 18: 4,673,912 L558P probably damaging Het
Kmt2d A G 15: 98,839,705 I5170T unknown Het
Lamb3 T C 1: 193,326,011 F251L probably benign Het
Lpxn T A 19: 12,824,972 D220E probably benign Het
Mex3a T A 3: 88,537,173 F519I probably damaging Het
Mfap1a T C 2: 121,506,520 M8V probably benign Het
Mical3 T A 6: 120,957,751 D1789V probably damaging Het
Mpdz G A 4: 81,317,668 Q1211* probably null Het
Myd88 A G 9: 119,338,004 probably null Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Ndst4 C T 3: 125,724,736 S354L probably benign Het
Ntn4 A G 10: 93,644,626 T71A probably benign Het
Olfr392 A G 11: 73,814,317 I255T probably damaging Het
Olfr512 T A 7: 108,713,835 W161R probably damaging Het
Olfr683 T G 7: 105,144,291 M7L probably benign Het
Olfr863-ps1 A G 9: 19,941,904 W179R probably benign Het
Omd A C 13: 49,592,361 M416L probably benign Het
Oog1 G C 12: 87,608,316 L411F probably damaging Het
Pde4dip T C 3: 97,753,152 Q670R possibly damaging Het
Pex13 C A 11: 23,651,034 G272V probably damaging Het
Pfkl A T 10: 77,988,247 V769D probably damaging Het
Pkn3 A G 2: 30,078,320 Y10C probably benign Het
Pomgnt1 A G 4: 116,156,181 H500R probably damaging Het
Rasef T C 4: 73,727,645 T496A probably benign Het
Rgs6 A G 12: 83,137,392 S459G probably benign Het
Serpinb6b A T 13: 32,975,019 M187L Het
Shcbp1l A G 1: 153,445,881 I408M possibly damaging Het
Slc25a45 T C 19: 5,884,939 V272A probably damaging Het
Tlr4 T C 4: 66,827,923 probably null Het
Unc80 A T 1: 66,510,905 N774I Het
Urb2 T A 8: 124,029,874 S773R possibly damaging Het
Vmn1r35 A T 6: 66,679,131 V185E probably damaging Het
Vps13d A C 4: 145,069,957 V3691G Het
Wdtc1 A G 4: 133,295,373 V554A possibly damaging Het
Xrn1 A T 9: 95,969,474 M182L probably damaging Het
Zfp747 T C 7: 127,374,026 H324R possibly damaging Het
Other mutations in Myof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Myof APN 19 37960934 missense probably benign 0.16
IGL00764:Myof APN 19 37974923 missense probably benign 0.04
IGL00801:Myof APN 19 37986073 missense probably damaging 0.99
IGL01084:Myof APN 19 37936436 missense probably damaging 1.00
IGL01368:Myof APN 19 37936457 missense probably damaging 0.97
IGL01472:Myof APN 19 37923076 missense probably benign
IGL01785:Myof APN 19 37980423 nonsense probably null
IGL02205:Myof APN 19 37924635 missense probably damaging 1.00
IGL02268:Myof APN 19 37954429 missense possibly damaging 0.50
IGL02268:Myof APN 19 37974863 missense possibly damaging 0.90
IGL02339:Myof APN 19 37972213 missense possibly damaging 0.46
IGL02433:Myof APN 19 37972193 missense probably benign 0.05
IGL02481:Myof APN 19 37937913 nonsense probably null
IGL02536:Myof APN 19 37949655 missense probably damaging 0.97
IGL02682:Myof APN 19 37921481 missense probably benign 0.09
IGL02732:Myof APN 19 37977716 missense possibly damaging 0.50
IGL02887:Myof APN 19 37920779 critical splice acceptor site probably null
IGL03114:Myof APN 19 37903861 missense probably damaging 1.00
IGL03137:Myof APN 19 37974889 missense probably damaging 1.00
IGL03340:Myof APN 19 37911159 missense probably damaging 1.00
PIT4791001:Myof UTSW 19 37982958 critical splice donor site probably null
R0024:Myof UTSW 19 37915740 missense probably damaging 0.98
R0140:Myof UTSW 19 37951556 nonsense probably null
R0309:Myof UTSW 19 37981266 missense probably benign 0.12
R0330:Myof UTSW 19 37935878 missense probably damaging 1.00
R0345:Myof UTSW 19 38024345 missense probably damaging 1.00
R0349:Myof UTSW 19 37910969 missense probably damaging 0.99
R0463:Myof UTSW 19 37916504 missense probably damaging 1.00
R0507:Myof UTSW 19 37901277 missense possibly damaging 0.94
R0512:Myof UTSW 19 37954524 missense possibly damaging 0.54
R0608:Myof UTSW 19 37916504 missense probably damaging 1.00
R0723:Myof UTSW 19 37981260 missense probably damaging 1.00
R1081:Myof UTSW 19 37986088 missense probably damaging 0.99
R1196:Myof UTSW 19 37910960 missense probably damaging 1.00
R1243:Myof UTSW 19 37936092 missense probably damaging 1.00
R1371:Myof UTSW 19 37903668 splice site probably benign
R1381:Myof UTSW 19 37995485 missense probably damaging 1.00
R1419:Myof UTSW 19 37901911 missense probably damaging 1.00
R1527:Myof UTSW 19 37924619 missense probably damaging 1.00
R1672:Myof UTSW 19 37943479 missense probably damaging 1.00
R1864:Myof UTSW 19 37986705 missense probably benign
R1914:Myof UTSW 19 37977693 missense probably damaging 1.00
R1915:Myof UTSW 19 37977693 missense probably damaging 1.00
R1970:Myof UTSW 19 37945634 missense probably damaging 0.99
R2062:Myof UTSW 19 37915746 missense possibly damaging 0.94
R2144:Myof UTSW 19 37981221 critical splice donor site probably null
R2243:Myof UTSW 19 37901319 missense probably damaging 1.00
R2339:Myof UTSW 19 37937927 missense probably damaging 1.00
R2484:Myof UTSW 19 37903843 missense probably benign 0.13
R2880:Myof UTSW 19 37923025 missense probably benign 0.04
R3418:Myof UTSW 19 37922978 missense probably damaging 0.97
R3967:Myof UTSW 19 37901263 missense probably damaging 1.00
R3967:Myof UTSW 19 38022610 missense possibly damaging 0.59
R3970:Myof UTSW 19 37901263 missense probably damaging 1.00
R3970:Myof UTSW 19 38022610 missense possibly damaging 0.59
R4238:Myof UTSW 19 37923008 nonsense probably null
R4405:Myof UTSW 19 37922978 missense probably damaging 0.97
R4406:Myof UTSW 19 37922978 missense probably damaging 0.97
R4407:Myof UTSW 19 37922978 missense probably damaging 0.97
R4408:Myof UTSW 19 37922978 missense probably damaging 0.97
R4561:Myof UTSW 19 37922990 missense probably benign
R4606:Myof UTSW 19 37967099 missense probably damaging 1.00
R4778:Myof UTSW 19 37949563 missense probably damaging 1.00
R4801:Myof UTSW 19 37945738 missense probably benign 0.24
R4802:Myof UTSW 19 37945738 missense probably benign 0.24
R4812:Myof UTSW 19 37916559 missense probably damaging 1.00
R4884:Myof UTSW 19 37942357 missense probably damaging 1.00
R4964:Myof UTSW 19 37935852 missense probably damaging 0.97
R4966:Myof UTSW 19 37935852 missense probably damaging 0.97
R5069:Myof UTSW 19 37905325 missense possibly damaging 0.65
R5181:Myof UTSW 19 37932623 missense possibly damaging 0.95
R5376:Myof UTSW 19 37916400 missense probably damaging 1.00
R5384:Myof UTSW 19 37952987 missense probably damaging 0.98
R5543:Myof UTSW 19 37981330 missense probably benign 0.00
R5626:Myof UTSW 19 37922990 missense probably benign
R5865:Myof UTSW 19 37910934 missense probably damaging 1.00
R5919:Myof UTSW 19 38024370 missense possibly damaging 0.95
R5924:Myof UTSW 19 37982973 missense probably damaging 0.97
R5997:Myof UTSW 19 37905299 missense possibly damaging 0.90
R5999:Myof UTSW 19 37939856 nonsense probably null
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6039:Myof UTSW 19 37977684 missense probably damaging 1.00
R6041:Myof UTSW 19 37924620 missense probably damaging 1.00
R6051:Myof UTSW 19 38024361 missense probably damaging 1.00
R6057:Myof UTSW 19 37926981 critical splice donor site probably null
R6089:Myof UTSW 19 37967060 missense probably benign 0.37
R6195:Myof UTSW 19 37913357 missense possibly damaging 0.89
R6478:Myof UTSW 19 37903831 missense probably damaging 1.00
R6545:Myof UTSW 19 37942297 missense possibly damaging 0.67
R6655:Myof UTSW 19 37934791 missense probably damaging 1.00
R6715:Myof UTSW 19 37968346 missense probably benign 0.04
R6737:Myof UTSW 19 37943514 missense probably benign 0.01
R6837:Myof UTSW 19 37922956 critical splice donor site probably null
R7096:Myof UTSW 19 37936200 missense probably damaging 1.00
R7308:Myof UTSW 19 37910911 missense probably damaging 0.98
R7328:Myof UTSW 19 37916399 missense probably damaging 1.00
R7485:Myof UTSW 19 37951491 nonsense probably null
R7554:Myof UTSW 19 37954510 missense probably benign 0.09
R7759:Myof UTSW 19 37939898 missense probably benign 0.00
R7779:Myof UTSW 19 37939390 missense probably damaging 1.00
R8116:Myof UTSW 19 37932719 missense probably damaging 0.99
R8264:Myof UTSW 19 37921433 missense probably damaging 1.00
R8415:Myof UTSW 19 37995424 missense probably benign
R8756:Myof UTSW 19 37939952 missense probably benign
R8777:Myof UTSW 19 37980393 missense probably benign 0.01
R8777-TAIL:Myof UTSW 19 37980393 missense probably benign 0.01
R8835:Myof UTSW 19 37967099 missense possibly damaging 0.92
R9396:Myof UTSW 19 37934846 missense probably damaging 1.00
R9450:Myof UTSW 19 37960926 missense probably damaging 1.00
R9451:Myof UTSW 19 37977648 critical splice donor site probably null
R9537:Myof UTSW 19 37907606 missense probably damaging 1.00
R9592:Myof UTSW 19 38043289 missense probably damaging 0.99
R9616:Myof UTSW 19 37934815 missense possibly damaging 0.52
X0024:Myof UTSW 19 37974597 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGTCAGAGAGATCTAGAACGGTATC -3'
(R):5'- CGGTCTCTCCACATGTAGAC -3'

Sequencing Primer
(F):5'- CGGTATCTAGATATAGAACGGCC -3'
(R):5'- CCACATGTAGACTCATTGAGTTTGC -3'
Posted On 2022-05-16