Incidental Mutation 'R9417:Usp20'
ID 712082
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms 1700055M05Rik, Vdu2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9417 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 30982279-31023586 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 30983018 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028205] [ENSMUST00000061544] [ENSMUST00000102849] [ENSMUST00000138161] [ENSMUST00000142232]
AlphaFold Q8C6M1
Predicted Effect probably benign
Transcript: ENSMUST00000028205
SMART Domains Protein: ENSMUSP00000028205
Gene: ENSMUSG00000026851

DomainStartEndE-ValueType
coiled coil region 10 37 N/A INTRINSIC
Pfam:Hep_59 101 197 3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061544
SMART Domains Protein: ENSMUSP00000060167
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.2e-18 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 210 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102849
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138161
SMART Domains Protein: ENSMUSP00000116696
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
Pfam:zf-UBP 30 77 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142232
SMART Domains Protein: ENSMUSP00000115347
Gene: ENSMUSG00000026854

DomainStartEndE-ValueType
PDB:2UZG|A 70 99 5e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,867,965 Y139H unknown Het
5430419D17Rik A G 7: 131,250,489 D818G possibly damaging Het
Akr1b10 T C 6: 34,394,092 V259A probably benign Het
Aldh5a1 A T 13: 24,911,690 N481K probably damaging Het
Ankrd26 A T 6: 118,527,764 M728K possibly damaging Het
Asic1 A G 15: 99,692,524 M52V probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Cacna2d2 C A 9: 107,515,490 Y544* probably null Het
Chd4 A G 6: 125,120,725 N1403S probably damaging Het
Cldn4 G T 5: 134,946,320 N142K probably benign Het
Dll1 T C 17: 15,373,448 Y219C probably damaging Het
Dnah2 T A 11: 69,436,164 I3539F probably damaging Het
Egfr T A 11: 16,875,067 L469* probably null Het
Elmo1 A G 13: 20,572,403 N554D possibly damaging Het
Fam234a A C 17: 26,216,251 F306L probably benign Het
Fbl G A 7: 28,174,627 G45D unknown Het
Fbxw10 C A 11: 62,862,696 C505* probably null Het
Ftcd G A 10: 76,581,319 G221S probably damaging Het
Gad1 A G 2: 70,587,372 D305G possibly damaging Het
Gdpd4 A G 7: 97,957,867 D16G probably benign Het
Gsdmc3 T A 15: 63,866,814 D133V possibly damaging Het
Hpdl T C 4: 116,820,620 T215A possibly damaging Het
Igsf10 A T 3: 59,329,105 N1218K possibly damaging Het
Isg20 C T 7: 78,919,857 P192L probably benign Het
Itga7 C T 10: 128,957,674 T126M unknown Het
Krr1 A G 10: 111,977,121 I134V probably benign Het
Krt71 T A 15: 101,738,296 T326S probably benign Het
Lamb1 T A 12: 31,287,984 V480E probably damaging Het
Mmp19 T A 10: 128,794,654 L102Q possibly damaging Het
Mtor T A 4: 148,538,319 L1952* probably null Het
Myo15 T A 11: 60,487,417 V215E Het
Nfs1 T A 2: 156,123,931 K77* probably null Het
Olfr460 T A 6: 40,572,162 Y259N Het
Olfr593 A T 7: 103,211,949 I30F possibly damaging Het
Pcdhga4 T C 18: 37,687,507 F703S probably damaging Het
Pdzd7 A G 19: 45,045,583 S21P probably damaging Het
Pitrm1 A T 13: 6,567,358 I583F possibly damaging Het
Ppox A G 1: 171,280,281 L77P unknown Het
Ppp1r37 G T 7: 19,535,733 R114S probably damaging Het
Ppp4r3b T C 11: 29,194,598 V316A probably benign Het
Ptprd A G 4: 75,947,098 I1214T probably damaging Het
Rasal3 A G 17: 32,396,467 F466L probably benign Het
Ric8b A T 10: 84,925,583 D41V probably benign Het
Rin2 T C 2: 145,844,793 S81P probably benign Het
Sft2d1 T A 17: 8,323,307 C128S probably damaging Het
Skint1 T C 4: 112,021,312 V147A probably benign Het
Slc9c1 T C 16: 45,593,485 V992A probably benign Het
Sst A G 16: 23,889,737 S115P probably damaging Het
Sv2b G T 7: 75,120,024 S590Y probably damaging Het
Syne1 C T 10: 5,132,021 V868I probably benign Het
Tex35 T C 1: 157,107,219 I42V possibly damaging Het
Tlr2 T C 3: 83,837,585 N397S probably damaging Het
Tmem202 A G 9: 59,524,716 probably null Het
Ttc26 T C 6: 38,409,451 F369S probably damaging Het
Usp32 C T 11: 84,994,543 R1226Q probably damaging Het
Usp47 C T 7: 112,089,594 A736V possibly damaging Het
Vmn2r-ps117 T A 17: 18,823,775 L371* probably null Het
Wwp1 T A 4: 19,662,215 N127Y possibly damaging Het
Yae1d1 A T 13: 17,993,185 V41D probably damaging Het
Zbtb8b T C 4: 129,432,724 D216G probably benign Het
Zfp462 T C 4: 55,016,988 S903P probably benign Het
Zranb1 G A 7: 132,983,737 G638D probably damaging Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 31004950 missense probably damaging 1.00
IGL01444:Usp20 APN 2 30998789 start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 31011794 missense probably benign 0.04
IGL01785:Usp20 APN 2 31017163 missense probably benign 0.02
IGL01786:Usp20 APN 2 31017163 missense probably benign 0.02
IGL02129:Usp20 APN 2 31004450 missense probably benign 0.43
IGL02147:Usp20 APN 2 31006401 missense probably damaging 1.00
IGL03396:Usp20 APN 2 31011717 missense probably benign
BB007:Usp20 UTSW 2 31010544 missense probably benign 0.21
BB017:Usp20 UTSW 2 31010544 missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 31017486 missense possibly damaging 0.47
R0111:Usp20 UTSW 2 31002612 missense probably damaging 1.00
R0369:Usp20 UTSW 2 31011104 missense probably benign 0.00
R0479:Usp20 UTSW 2 31017475 missense probably benign 0.18
R0538:Usp20 UTSW 2 31004450 missense probably damaging 0.99
R1023:Usp20 UTSW 2 31007813 missense probably damaging 1.00
R1183:Usp20 UTSW 2 31011785 missense probably benign 0.17
R1635:Usp20 UTSW 2 31018818 missense probably benign 0.03
R2114:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2115:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2116:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2117:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2232:Usp20 UTSW 2 31018738 missense probably benign 0.13
R2244:Usp20 UTSW 2 31010331 missense possibly damaging 0.65
R2883:Usp20 UTSW 2 31018800 missense probably benign
R4734:Usp20 UTSW 2 31019824 missense probably benign 0.31
R5507:Usp20 UTSW 2 31010226 missense probably benign
R5770:Usp20 UTSW 2 31017508 missense probably damaging 1.00
R5862:Usp20 UTSW 2 31006449 nonsense probably null
R6315:Usp20 UTSW 2 31017758 missense possibly damaging 0.70
R7603:Usp20 UTSW 2 31011474 missense probably damaging 1.00
R7887:Usp20 UTSW 2 31020894 missense probably benign 0.34
R7930:Usp20 UTSW 2 31010544 missense probably benign 0.21
R8542:Usp20 UTSW 2 31011624 missense possibly damaging 0.94
R8965:Usp20 UTSW 2 31011785 missense possibly damaging 0.77
R9079:Usp20 UTSW 2 31005108 intron probably benign
R9226:Usp20 UTSW 2 31017400 missense probably damaging 0.99
R9459:Usp20 UTSW 2 31011012 missense probably damaging 0.99
Z1176:Usp20 UTSW 2 31019818 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTTGAGAGCTTGGGAGGACTC -3'
(R):5'- ACACCCTGCAGCTGTGAAAG -3'

Sequencing Primer
(F):5'- AGGACTGTCGCTCTGCCATAAG -3'
(R):5'- TGTGAAAGCTCTGTCCCCAAC -3'
Posted On 2022-05-16