Incidental Mutation 'R9417:Usp32'
ID 712126
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9417 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 84994543 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1226 (R1226Q)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108075
AA Change: R1226Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: R1226Q

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,867,965 Y139H unknown Het
5430419D17Rik A G 7: 131,250,489 D818G possibly damaging Het
Akr1b10 T C 6: 34,394,092 V259A probably benign Het
Aldh5a1 A T 13: 24,911,690 N481K probably damaging Het
Ankrd26 A T 6: 118,527,764 M728K possibly damaging Het
Asic1 A G 15: 99,692,524 M52V probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Cacna2d2 C A 9: 107,515,490 Y544* probably null Het
Chd4 A G 6: 125,120,725 N1403S probably damaging Het
Cldn4 G T 5: 134,946,320 N142K probably benign Het
Dll1 T C 17: 15,373,448 Y219C probably damaging Het
Dnah2 T A 11: 69,436,164 I3539F probably damaging Het
Egfr T A 11: 16,875,067 L469* probably null Het
Elmo1 A G 13: 20,572,403 N554D possibly damaging Het
Fam234a A C 17: 26,216,251 F306L probably benign Het
Fbl G A 7: 28,174,627 G45D unknown Het
Fbxw10 C A 11: 62,862,696 C505* probably null Het
Ftcd G A 10: 76,581,319 G221S probably damaging Het
Gad1 A G 2: 70,587,372 D305G possibly damaging Het
Gdpd4 A G 7: 97,957,867 D16G probably benign Het
Gsdmc3 T A 15: 63,866,814 D133V possibly damaging Het
Hpdl T C 4: 116,820,620 T215A possibly damaging Het
Igsf10 A T 3: 59,329,105 N1218K possibly damaging Het
Isg20 C T 7: 78,919,857 P192L probably benign Het
Itga7 C T 10: 128,957,674 T126M unknown Het
Krr1 A G 10: 111,977,121 I134V probably benign Het
Krt71 T A 15: 101,738,296 T326S probably benign Het
Lamb1 T A 12: 31,287,984 V480E probably damaging Het
Mmp19 T A 10: 128,794,654 L102Q possibly damaging Het
Mtor T A 4: 148,538,319 L1952* probably null Het
Myo15 T A 11: 60,487,417 V215E Het
Nfs1 T A 2: 156,123,931 K77* probably null Het
Olfr460 T A 6: 40,572,162 Y259N Het
Olfr593 A T 7: 103,211,949 I30F possibly damaging Het
Pcdhga4 T C 18: 37,687,507 F703S probably damaging Het
Pdzd7 A G 19: 45,045,583 S21P probably damaging Het
Pitrm1 A T 13: 6,567,358 I583F possibly damaging Het
Ppox A G 1: 171,280,281 L77P unknown Het
Ppp1r37 G T 7: 19,535,733 R114S probably damaging Het
Ppp4r3b T C 11: 29,194,598 V316A probably benign Het
Ptprd A G 4: 75,947,098 I1214T probably damaging Het
Rasal3 A G 17: 32,396,467 F466L probably benign Het
Ric8b A T 10: 84,925,583 D41V probably benign Het
Rin2 T C 2: 145,844,793 S81P probably benign Het
Sft2d1 T A 17: 8,323,307 C128S probably damaging Het
Skint1 T C 4: 112,021,312 V147A probably benign Het
Slc9c1 T C 16: 45,593,485 V992A probably benign Het
Sst A G 16: 23,889,737 S115P probably damaging Het
Sv2b G T 7: 75,120,024 S590Y probably damaging Het
Syne1 C T 10: 5,132,021 V868I probably benign Het
Tex35 T C 1: 157,107,219 I42V possibly damaging Het
Tlr2 T C 3: 83,837,585 N397S probably damaging Het
Tmem202 A G 9: 59,524,716 probably null Het
Ttc26 T C 6: 38,409,451 F369S probably damaging Het
Usp20 A G 2: 30,983,018 probably null Het
Usp47 C T 7: 112,089,594 A736V possibly damaging Het
Vmn2r-ps117 T A 17: 18,823,775 L371* probably null Het
Wwp1 T A 4: 19,662,215 N127Y possibly damaging Het
Yae1d1 A T 13: 17,993,185 V41D probably damaging Het
Zbtb8b T C 4: 129,432,724 D216G probably benign Het
Zfp462 T C 4: 55,016,988 S903P probably benign Het
Zranb1 G A 7: 132,983,737 G638D probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAATCCTGCTAATGACTCCTCTAACTC -3'
(R):5'- TGCATTGCTCAAAGACTAGTTTGG -3'

Sequencing Primer
(F):5'- CACTAGATTCTTCTCATAGACAGGGC -3'
(R):5'- GGATTGTACTTCACCACCACATGTAG -3'
Posted On 2022-05-16