Incidental Mutation 'R9417:Slc9c1'
ID 712136
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R9417 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45413848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 992 (V992A)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: V992A

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: V992A

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,786,202 (GRCm39) Y139H unknown Het
Akr1b10 T C 6: 34,371,027 (GRCm39) V259A probably benign Het
Aldh5a1 A T 13: 25,095,673 (GRCm39) N481K probably damaging Het
Ankrd26 A T 6: 118,504,725 (GRCm39) M728K possibly damaging Het
Asic1 A G 15: 99,590,405 (GRCm39) M52V probably benign Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cacna2d2 C A 9: 107,392,689 (GRCm39) Y544* probably null Het
Cdcp3 A G 7: 130,852,218 (GRCm39) D818G possibly damaging Het
Chd4 A G 6: 125,097,688 (GRCm39) N1403S probably damaging Het
Cldn4 G T 5: 134,975,174 (GRCm39) N142K probably benign Het
Cracd GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 77,004,801 (GRCm39) probably benign Het
Dll1 T C 17: 15,593,710 (GRCm39) Y219C probably damaging Het
Dnah2 T A 11: 69,326,990 (GRCm39) I3539F probably damaging Het
Egfr T A 11: 16,825,067 (GRCm39) L469* probably null Het
Elmo1 A G 13: 20,756,573 (GRCm39) N554D possibly damaging Het
Fam234a A C 17: 26,435,225 (GRCm39) F306L probably benign Het
Fbl G A 7: 27,874,052 (GRCm39) G45D unknown Het
Fbxw10 C A 11: 62,753,522 (GRCm39) C505* probably null Het
Ftcd G A 10: 76,417,153 (GRCm39) G221S probably damaging Het
Gad1 A G 2: 70,417,716 (GRCm39) D305G possibly damaging Het
Gdpd4 A G 7: 97,607,074 (GRCm39) D16G probably benign Het
Gsdmc3 T A 15: 63,738,663 (GRCm39) D133V possibly damaging Het
Hpdl T C 4: 116,677,817 (GRCm39) T215A possibly damaging Het
Ift56 T C 6: 38,386,386 (GRCm39) F369S probably damaging Het
Igsf10 A T 3: 59,236,526 (GRCm39) N1218K possibly damaging Het
Isg20 C T 7: 78,569,605 (GRCm39) P192L probably benign Het
Itga7 C T 10: 128,793,543 (GRCm39) T126M unknown Het
Krr1 A G 10: 111,813,026 (GRCm39) I134V probably benign Het
Krt71 T A 15: 101,646,731 (GRCm39) T326S probably benign Het
Lamb1 T A 12: 31,337,983 (GRCm39) V480E probably damaging Het
Mmp19 T A 10: 128,630,523 (GRCm39) L102Q possibly damaging Het
Mtor T A 4: 148,622,776 (GRCm39) L1952* probably null Het
Myo15a T A 11: 60,378,243 (GRCm39) V215E Het
Nfs1 T A 2: 155,965,851 (GRCm39) K77* probably null Het
Or52s1 A T 7: 102,861,156 (GRCm39) I30F possibly damaging Het
Or9a4 T A 6: 40,549,096 (GRCm39) Y259N Het
Pcdhga4 T C 18: 37,820,560 (GRCm39) F703S probably damaging Het
Pdzd7 A G 19: 45,034,022 (GRCm39) S21P probably damaging Het
Pitrm1 A T 13: 6,617,394 (GRCm39) I583F possibly damaging Het
Ppox A G 1: 171,107,855 (GRCm39) L77P unknown Het
Ppp1r37 G T 7: 19,269,658 (GRCm39) R114S probably damaging Het
Ppp4r3b T C 11: 29,144,598 (GRCm39) V316A probably benign Het
Ptprd A G 4: 75,865,335 (GRCm39) I1214T probably damaging Het
Rasal3 A G 17: 32,615,441 (GRCm39) F466L probably benign Het
Ric8b A T 10: 84,761,447 (GRCm39) D41V probably benign Het
Rin2 T C 2: 145,686,713 (GRCm39) S81P probably benign Het
Sft2d1 T A 17: 8,542,139 (GRCm39) C128S probably damaging Het
Skint1 T C 4: 111,878,509 (GRCm39) V147A probably benign Het
Sst A G 16: 23,708,487 (GRCm39) S115P probably damaging Het
Sv2b G T 7: 74,769,772 (GRCm39) S590Y probably damaging Het
Syne1 C T 10: 5,082,021 (GRCm39) V868I probably benign Het
Tex35 T C 1: 156,934,789 (GRCm39) I42V possibly damaging Het
Tlr2 T C 3: 83,744,892 (GRCm39) N397S probably damaging Het
Tmem202 A G 9: 59,431,999 (GRCm39) probably null Het
Usp20 A G 2: 30,873,030 (GRCm39) probably null Het
Usp32 C T 11: 84,885,369 (GRCm39) R1226Q probably damaging Het
Usp47 C T 7: 111,688,801 (GRCm39) A736V possibly damaging Het
Vmn2r-ps117 T A 17: 19,044,037 (GRCm39) L371* probably null Het
Wwp1 T A 4: 19,662,215 (GRCm39) N127Y possibly damaging Het
Yae1d1 A T 13: 18,167,770 (GRCm39) V41D probably damaging Het
Zbtb8b T C 4: 129,326,517 (GRCm39) D216G probably benign Het
Zfp462 T C 4: 55,016,988 (GRCm39) S903P probably benign Het
Zranb1 G A 7: 132,585,466 (GRCm39) G638D probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGGTGACATAAATTAACCAGCG -3'
(R):5'- TTGAAACTATTTTGCTAGGGCG -3'

Sequencing Primer
(F):5'- GTGACATAAATTAACCAGCGTATGTG -3'
(R):5'- AGCTAGCCTCTGAATCCAGTGATG -3'
Posted On 2022-05-16