Incidental Mutation 'R9417:Slc9c1'
ID 712136
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, Slc9a10, spermNHE
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock # R9417 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45535309-45607001 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45593485 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 992 (V992A)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: V992A

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: V992A

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,867,965 Y139H unknown Het
5430419D17Rik A G 7: 131,250,489 D818G possibly damaging Het
Akr1b10 T C 6: 34,394,092 V259A probably benign Het
Aldh5a1 A T 13: 24,911,690 N481K probably damaging Het
Ankrd26 A T 6: 118,527,764 M728K possibly damaging Het
Asic1 A G 15: 99,692,524 M52V probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Cacna2d2 C A 9: 107,515,490 Y544* probably null Het
Chd4 A G 6: 125,120,725 N1403S probably damaging Het
Cldn4 G T 5: 134,946,320 N142K probably benign Het
Dll1 T C 17: 15,373,448 Y219C probably damaging Het
Dnah2 T A 11: 69,436,164 I3539F probably damaging Het
Egfr T A 11: 16,875,067 L469* probably null Het
Elmo1 A G 13: 20,572,403 N554D possibly damaging Het
Fam234a A C 17: 26,216,251 F306L probably benign Het
Fbl G A 7: 28,174,627 G45D unknown Het
Fbxw10 C A 11: 62,862,696 C505* probably null Het
Ftcd G A 10: 76,581,319 G221S probably damaging Het
Gad1 A G 2: 70,587,372 D305G possibly damaging Het
Gdpd4 A G 7: 97,957,867 D16G probably benign Het
Gsdmc3 T A 15: 63,866,814 D133V possibly damaging Het
Hpdl T C 4: 116,820,620 T215A possibly damaging Het
Igsf10 A T 3: 59,329,105 N1218K possibly damaging Het
Isg20 C T 7: 78,919,857 P192L probably benign Het
Itga7 C T 10: 128,957,674 T126M unknown Het
Krr1 A G 10: 111,977,121 I134V probably benign Het
Krt71 T A 15: 101,738,296 T326S probably benign Het
Lamb1 T A 12: 31,287,984 V480E probably damaging Het
Mmp19 T A 10: 128,794,654 L102Q possibly damaging Het
Mtor T A 4: 148,538,319 L1952* probably null Het
Myo15 T A 11: 60,487,417 V215E Het
Nfs1 T A 2: 156,123,931 K77* probably null Het
Olfr460 T A 6: 40,572,162 Y259N Het
Olfr593 A T 7: 103,211,949 I30F possibly damaging Het
Pcdhga4 T C 18: 37,687,507 F703S probably damaging Het
Pdzd7 A G 19: 45,045,583 S21P probably damaging Het
Pitrm1 A T 13: 6,567,358 I583F possibly damaging Het
Ppox A G 1: 171,280,281 L77P unknown Het
Ppp1r37 G T 7: 19,535,733 R114S probably damaging Het
Ppp4r3b T C 11: 29,194,598 V316A probably benign Het
Ptprd A G 4: 75,947,098 I1214T probably damaging Het
Rasal3 A G 17: 32,396,467 F466L probably benign Het
Ric8b A T 10: 84,925,583 D41V probably benign Het
Rin2 T C 2: 145,844,793 S81P probably benign Het
Sft2d1 T A 17: 8,323,307 C128S probably damaging Het
Skint1 T C 4: 112,021,312 V147A probably benign Het
Sst A G 16: 23,889,737 S115P probably damaging Het
Sv2b G T 7: 75,120,024 S590Y probably damaging Het
Syne1 C T 10: 5,132,021 V868I probably benign Het
Tex35 T C 1: 157,107,219 I42V possibly damaging Het
Tlr2 T C 3: 83,837,585 N397S probably damaging Het
Tmem202 A G 9: 59,524,716 probably null Het
Ttc26 T C 6: 38,409,451 F369S probably damaging Het
Usp20 A G 2: 30,983,018 probably null Het
Usp32 C T 11: 84,994,543 R1226Q probably damaging Het
Usp47 C T 7: 112,089,594 A736V possibly damaging Het
Vmn2r-ps117 T A 17: 18,823,775 L371* probably null Het
Wwp1 T A 4: 19,662,215 N127Y possibly damaging Het
Yae1d1 A T 13: 17,993,185 V41D probably damaging Het
Zbtb8b T C 4: 129,432,724 D216G probably benign Het
Zfp462 T C 4: 55,016,988 S903P probably benign Het
Zranb1 G A 7: 132,983,737 G638D probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45580127 missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45599781 missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45577912 missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45550188 missense probably benign 0.01
R9519:Slc9c1 UTSW 16 45575407 missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45560342 missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45580214 missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45547663 missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45580253 missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGGTGACATAAATTAACCAGCG -3'
(R):5'- TTGAAACTATTTTGCTAGGGCG -3'

Sequencing Primer
(F):5'- GTGACATAAATTAACCAGCGTATGTG -3'
(R):5'- AGCTAGCCTCTGAATCCAGTGATG -3'
Posted On 2022-05-16