Incidental Mutation 'R9418:Mug2'
ID 712165
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R9418 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 121983720-122062924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122017700 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 479 (V479E)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: V479E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: V479E

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik G A 5: 138,645,317 (GRCm39) G401R probably damaging Het
Adgrf5 G A 17: 43,737,864 (GRCm39) V233I probably benign Het
Ankrd34b A G 13: 92,575,232 (GRCm39) K155E probably damaging Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
Ccdc141 A T 2: 76,871,766 (GRCm39) H839Q probably benign Het
Ccdc18 T C 5: 108,303,669 (GRCm39) L251P probably damaging Het
Ciita G T 16: 10,319,765 (GRCm39) E63* probably null Het
Cmya5 T C 13: 93,226,209 (GRCm39) T2960A probably benign Het
Cyp2b13 A T 7: 25,761,110 (GRCm39) I56F probably benign Het
Dcaf4 A T 12: 83,586,606 (GRCm39) Y422F probably benign Het
Dhrs7b A T 11: 60,746,594 (GRCm39) I228F probably damaging Het
Drosha T C 15: 12,885,167 (GRCm39) S853P probably benign Het
Dzank1 C T 2: 144,355,408 (GRCm39) V96M probably damaging Het
Fap G A 2: 62,385,181 (GRCm39) Q65* probably null Het
Fbxo47 T A 11: 97,747,067 (GRCm39) N333I possibly damaging Het
Fem1al C T 11: 29,774,632 (GRCm39) C275Y probably damaging Het
Fktn G A 4: 53,734,854 (GRCm39) G125D probably benign Het
Gpr171 T C 3: 59,004,999 (GRCm39) T259A possibly damaging Het
Hectd2 T A 19: 36,589,574 (GRCm39) S595T probably benign Het
Hexa A G 9: 59,464,592 (GRCm39) I161V probably benign Het
Hira A G 16: 18,770,025 (GRCm39) T777A probably benign Het
Il2ra T C 2: 11,689,203 (GRCm39) F244S possibly damaging Het
Kcne3 A G 7: 99,833,385 (GRCm39) M1V probably null Het
Kcnj1 G A 9: 32,308,203 (GRCm39) C209Y probably damaging Het
Kcnj2 A T 11: 110,963,357 (GRCm39) I250F probably damaging Het
Krt26 C T 11: 99,228,741 (GRCm39) probably benign Het
Leng9 T C 7: 4,151,354 (GRCm39) T441A probably benign Het
Lingo2 T C 4: 35,709,035 (GRCm39) H315R probably benign Het
Lrrc7 A T 3: 157,908,023 (GRCm39) S266T possibly damaging Het
Mab21l4 A C 1: 93,087,710 (GRCm39) L48V probably benign Het
Mib1 A G 18: 10,812,064 (GRCm39) D987G probably damaging Het
Mrc1 T C 2: 14,234,358 (GRCm39) V12A probably benign Het
Mta1 G T 12: 113,094,987 (GRCm39) R415L probably damaging Het
Mylk3 C A 8: 86,091,444 (GRCm39) M120I possibly damaging Het
Or13c7c C T 4: 43,835,879 (GRCm39) V204M probably benign Het
Or2v2 G T 11: 49,004,484 (GRCm39) P23Q probably benign Het
Otog A T 7: 45,938,024 (GRCm39) Q1911L probably benign Het
Pcdh20 C T 14: 88,705,455 (GRCm39) C615Y probably benign Het
Pde1b A G 15: 103,433,464 (GRCm39) H294R probably damaging Het
Phldb3 A T 7: 24,328,354 (GRCm39) I633F probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,341,589 (GRCm39) probably null Het
Pip5k1b A G 19: 24,327,581 (GRCm39) V425A probably benign Het
Pramel39-ps G T 5: 94,451,001 (GRCm39) P375H probably damaging Het
Rab23 A T 1: 33,777,424 (GRCm39) E179D probably benign Het
Slc12a6 C A 2: 112,174,555 (GRCm39) L522I Het
Slc22a19 A T 19: 7,660,210 (GRCm39) M400K possibly damaging Het
Slc4a11 C T 2: 130,533,664 (GRCm39) A100T probably damaging Het
Spsb2 C A 6: 124,786,282 (GRCm39) A5D probably damaging Het
Tgfb1 A G 7: 25,391,952 (GRCm39) E169G probably damaging Het
Tm4sf5 T A 11: 70,401,134 (GRCm39) C117S probably damaging Het
Tmcc3 T C 10: 94,415,087 (GRCm39) L294P possibly damaging Het
Ubc T C 5: 125,464,466 (GRCm39) Y287C probably damaging Het
Uroc1 G T 6: 90,313,880 (GRCm39) V56F probably benign Het
Ush1c A T 7: 45,872,292 (GRCm39) F237I probably damaging Het
Xxylt1 A T 16: 30,826,624 (GRCm39) Y230* probably null Het
Zfp467 A T 6: 48,415,990 (GRCm39) C221S probably damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122,024,446 (GRCm39) missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122,017,613 (GRCm39) missense probably damaging 0.99
IGL01314:Mug2 APN 6 122,058,238 (GRCm39) missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122,026,587 (GRCm39) splice site probably benign
IGL01477:Mug2 APN 6 122,058,643 (GRCm39) splice site probably benign
IGL01926:Mug2 APN 6 122,013,063 (GRCm39) splice site probably benign
IGL02019:Mug2 APN 6 122,024,394 (GRCm39) missense probably benign 0.02
IGL02305:Mug2 APN 6 122,013,015 (GRCm39) missense probably benign
IGL02310:Mug2 APN 6 122,036,082 (GRCm39) splice site probably benign
IGL02484:Mug2 APN 6 122,049,712 (GRCm39) missense probably damaging 1.00
IGL02516:Mug2 APN 6 122,047,802 (GRCm39) missense probably damaging 1.00
IGL02531:Mug2 APN 6 122,049,730 (GRCm39) missense probably damaging 1.00
IGL02666:Mug2 APN 6 122,058,285 (GRCm39) missense probably damaging 1.00
IGL02936:Mug2 APN 6 122,058,346 (GRCm39) critical splice donor site probably null
R0114:Mug2 UTSW 6 122,017,607 (GRCm39) missense probably damaging 1.00
R0119:Mug2 UTSW 6 122,013,022 (GRCm39) missense probably benign 0.00
R0123:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122,047,970 (GRCm39) splice site probably benign
R0225:Mug2 UTSW 6 122,051,673 (GRCm39) missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122,058,558 (GRCm39) missense probably damaging 1.00
R0763:Mug2 UTSW 6 122,052,253 (GRCm39) missense probably benign
R0959:Mug2 UTSW 6 122,062,454 (GRCm39) missense probably benign 0.33
R1104:Mug2 UTSW 6 122,036,014 (GRCm39) missense probably benign
R1239:Mug2 UTSW 6 122,058,637 (GRCm39) splice site probably benign
R1318:Mug2 UTSW 6 122,054,361 (GRCm39) missense probably damaging 1.00
R1460:Mug2 UTSW 6 122,017,492 (GRCm39) splice site probably benign
R1706:Mug2 UTSW 6 122,013,191 (GRCm39) splice site probably benign
R1761:Mug2 UTSW 6 122,051,664 (GRCm39) missense probably benign 0.20
R1901:Mug2 UTSW 6 122,048,801 (GRCm39) missense probably benign 0.02
R1913:Mug2 UTSW 6 122,047,829 (GRCm39) missense probably damaging 1.00
R1943:Mug2 UTSW 6 122,056,598 (GRCm39) missense probably benign
R2054:Mug2 UTSW 6 122,054,451 (GRCm39) missense probably damaging 1.00
R2060:Mug2 UTSW 6 122,056,571 (GRCm39) missense probably benign
R2420:Mug2 UTSW 6 122,060,419 (GRCm39) missense probably damaging 1.00
R2432:Mug2 UTSW 6 122,061,335 (GRCm39) missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R2918:Mug2 UTSW 6 122,051,683 (GRCm39) splice site probably null
R3423:Mug2 UTSW 6 122,024,465 (GRCm39) splice site probably benign
R3834:Mug2 UTSW 6 122,026,746 (GRCm39) critical splice donor site probably null
R3902:Mug2 UTSW 6 122,052,526 (GRCm39) missense probably damaging 1.00
R3941:Mug2 UTSW 6 122,040,522 (GRCm39) missense probably benign
R4227:Mug2 UTSW 6 122,017,691 (GRCm39) missense probably benign 0.10
R4284:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4287:Mug2 UTSW 6 122,040,632 (GRCm39) missense probably benign 0.00
R4377:Mug2 UTSW 6 122,047,966 (GRCm39) critical splice donor site probably null
R4419:Mug2 UTSW 6 122,056,589 (GRCm39) missense probably damaging 1.00
R4498:Mug2 UTSW 6 122,059,711 (GRCm39) missense probably damaging 0.99
R4566:Mug2 UTSW 6 122,056,597 (GRCm39) missense probably benign 0.00
R4690:Mug2 UTSW 6 122,013,255 (GRCm39) missense probably benign
R4732:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4733:Mug2 UTSW 6 122,048,831 (GRCm39) missense probably damaging 0.99
R4741:Mug2 UTSW 6 122,056,572 (GRCm39) missense probably benign
R4888:Mug2 UTSW 6 122,058,154 (GRCm39) missense probably damaging 1.00
R5199:Mug2 UTSW 6 122,017,619 (GRCm39) missense probably benign
R5347:Mug2 UTSW 6 122,058,551 (GRCm39) missense probably damaging 1.00
R5457:Mug2 UTSW 6 122,026,688 (GRCm39) nonsense probably null
R5495:Mug2 UTSW 6 122,056,609 (GRCm39) missense probably damaging 0.96
R5509:Mug2 UTSW 6 122,061,340 (GRCm39) missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122,060,459 (GRCm39) missense probably null 0.98
R6180:Mug2 UTSW 6 122,056,565 (GRCm39) missense probably benign 0.01
R6184:Mug2 UTSW 6 122,014,005 (GRCm39) missense probably benign
R6199:Mug2 UTSW 6 122,024,398 (GRCm39) missense probably benign 0.05
R6262:Mug2 UTSW 6 122,052,214 (GRCm39) missense probably damaging 1.00
R6416:Mug2 UTSW 6 122,059,713 (GRCm39) missense probably damaging 1.00
R6548:Mug2 UTSW 6 122,024,401 (GRCm39) missense probably damaging 1.00
R6703:Mug2 UTSW 6 122,055,653 (GRCm39) missense probably benign 0.25
R7106:Mug2 UTSW 6 122,059,680 (GRCm39) missense probably damaging 1.00
R7131:Mug2 UTSW 6 122,052,206 (GRCm39) missense probably damaging 1.00
R7372:Mug2 UTSW 6 122,060,425 (GRCm39) missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122,024,446 (GRCm39) missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122,017,529 (GRCm39) missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122,056,685 (GRCm39) missense probably benign 0.00
R7581:Mug2 UTSW 6 122,040,670 (GRCm39) missense probably damaging 1.00
R7582:Mug2 UTSW 6 122,056,603 (GRCm39) missense probably damaging 0.99
R7672:Mug2 UTSW 6 122,017,678 (GRCm39) missense probably benign 0.37
R7713:Mug2 UTSW 6 122,055,754 (GRCm39) missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122,058,317 (GRCm39) missense probably damaging 1.00
R7834:Mug2 UTSW 6 122,013,241 (GRCm39) missense probably benign
R7850:Mug2 UTSW 6 122,052,170 (GRCm39) missense probably damaging 1.00
R8029:Mug2 UTSW 6 122,058,504 (GRCm39) critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122,052,567 (GRCm39) missense probably benign 0.01
R8335:Mug2 UTSW 6 122,017,543 (GRCm39) missense probably benign
R8348:Mug2 UTSW 6 122,049,192 (GRCm39) nonsense probably null
R8557:Mug2 UTSW 6 122,040,660 (GRCm39) missense probably damaging 0.99
R8798:Mug2 UTSW 6 122,058,569 (GRCm39) missense probably damaging 1.00
R8823:Mug2 UTSW 6 122,040,648 (GRCm39) missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122,061,328 (GRCm39) missense probably damaging 1.00
R9153:Mug2 UTSW 6 122,017,627 (GRCm39) missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122,054,442 (GRCm39) missense probably benign 0.06
R9186:Mug2 UTSW 6 122,052,248 (GRCm39) missense probably damaging 0.99
R9464:Mug2 UTSW 6 122,028,690 (GRCm39) missense probably benign 0.01
R9622:Mug2 UTSW 6 122,028,751 (GRCm39) missense probably benign 0.29
Z1177:Mug2 UTSW 6 122,014,080 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGGCAATCTACAGCATAGTATTTTG -3'
(R):5'- TTTCAGGAAGAAATACCCAGATAGAAC -3'

Sequencing Primer
(F):5'- GTTGTTTCTCCAGGTCAACCACAAAG -3'
(R):5'- CCCAGATAGAACCCAATGTGTATAG -3'
Posted On 2022-05-16