Incidental Mutation 'R9419:Gm8251'
ID 712201
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Name predicted gene 8251
Synonyms
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R9419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 44055952-44061936 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44057775 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1388 (I1388V)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000168641
AA Change: I1388V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: I1388V

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,628,521 T30A unknown Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca12 A G 1: 71,303,490 Y944H possibly damaging Het
Adgrv1 T C 13: 81,508,768 N2869S probably benign Het
Ank1 C A 8: 23,084,809 Q140K probably damaging Het
Aspm T A 1: 139,457,185 M189K probably benign Het
Atp2b1 G T 10: 99,001,316 R539L possibly damaging Het
Camsap1 A G 2: 25,955,292 S152P Het
Catsperd A T 17: 56,651,821 I276L probably benign Het
Cbarp A G 10: 80,132,027 V460A probably damaging Het
Cdk11b A T 4: 155,639,845 T307S unknown Het
Chfr C T 5: 110,169,190 T643I probably damaging Het
Cnbd1 T C 4: 19,098,156 Q88R probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Dusp27 T C 1: 166,100,186 Q619R probably damaging Het
Ghdc G T 11: 100,770,255 A28D probably damaging Het
Gm5114 T C 7: 39,408,116 H693R possibly damaging Het
H2-M1 G T 17: 36,670,339 A268E probably damaging Het
Hsf5 A G 11: 87,638,109 N557D probably benign Het
Ighg2c A G 12: 113,287,395 probably benign Het
Il17ra C A 6: 120,481,294 Q469K possibly damaging Het
Ipo8 T A 6: 148,784,566 N809Y probably benign Het
Klra10 T A 6: 130,279,472 Q73L probably damaging Het
Lamb2 T C 9: 108,479,760 V3A unknown Het
Map3k9 T C 12: 81,780,567 Y103C probably damaging Het
Map4 T C 9: 110,052,961 S298P possibly damaging Het
Mtus2 T A 5: 148,306,641 N1254K probably damaging Het
Nap1l5 T A 6: 58,906,967 M1L probably benign Het
Nfxl1 G A 5: 72,559,298 probably benign Het
Nmd3 T C 3: 69,736,016 I227T probably benign Het
Olfr250 T G 9: 38,367,866 C97G probably damaging Het
Ptchd3 G A 11: 121,841,530 M415I possibly damaging Het
Rab28 A T 5: 41,635,839 S154R possibly damaging Het
Rin1 A G 19: 5,053,707 E567G probably damaging Het
Rrbp1 A C 2: 143,969,516 V806G probably benign Het
Sec63 T A 10: 42,803,905 L326Q probably damaging Het
Serinc2 T C 4: 130,255,522 T296A probably damaging Het
Skint10 G A 4: 112,715,784 L272F probably damaging Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Stag1 A G 9: 100,929,914 Q815R probably benign Het
Stat3 A G 11: 100,889,531 M735T possibly damaging Het
Stat3 A G 11: 100,893,912 I576T probably benign Het
Syne1 T C 10: 5,205,071 K5623E probably benign Het
Tas1r2 T C 4: 139,659,725 V165A possibly damaging Het
Tcaf3 A T 6: 42,596,782 D165E probably benign Het
Tex2 G A 11: 106,567,009 Q532* probably null Het
Utrn T C 10: 12,688,381 E1245G probably damaging Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
R8523:Gm8251 UTSW 1 44060834 missense possibly damaging 0.86
R8804:Gm8251 UTSW 1 44056649 missense probably benign
R8869:Gm8251 UTSW 1 44058265 missense possibly damaging 0.68
R8891:Gm8251 UTSW 1 44057124 missense probably benign 0.00
R9010:Gm8251 UTSW 1 44061473 missense possibly damaging 0.51
R9082:Gm8251 UTSW 1 44060714 missense unknown
R9097:Gm8251 UTSW 1 44058889 missense possibly damaging 0.73
R9157:Gm8251 UTSW 1 44057360 missense probably benign 0.33
R9262:Gm8251 UTSW 1 44057109 missense possibly damaging 0.73
R9313:Gm8251 UTSW 1 44057360 missense probably benign 0.33
R9433:Gm8251 UTSW 1 44056508 missense possibly damaging 0.86
R9485:Gm8251 UTSW 1 44056239 missense possibly damaging 0.72
R9511:Gm8251 UTSW 1 44059694 missense probably benign 0.00
R9573:Gm8251 UTSW 1 44056147 nonsense probably null
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCTAATGGTGTTACACTTTCTTGC -3'
(R):5'- CTTTGCCAGAGACTTCAGACAC -3'

Sequencing Primer
(F):5'- TGTTACACTTTCTTGCTTTTTGATG -3'
(R):5'- TATGTGCCACATTGCTACATACAC -3'
Posted On 2022-05-16