Incidental Mutation 'R9419:Camsap1'
ID 712205
Institutional Source Beutler Lab
Gene Symbol Camsap1
Ensembl Gene ENSMUSG00000026933
Gene Name calmodulin regulated spectrin-associated protein 1
Synonyms 9530003A05Rik, PRO2405
Accession Numbers

Genbank: NM_001115076; MGI: 3036242

Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock # R9419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 25926838-25983282 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25955292 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 152 (S152P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091268] [ENSMUST00000114167] [ENSMUST00000134882] [ENSMUST00000139937] [ENSMUST00000183461]
AlphaFold A2AHC3
Predicted Effect probably benign
Transcript: ENSMUST00000091268
SMART Domains Protein: ENSMUSP00000088812
Gene: ENSMUSG00000026933

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 228 311 3.3e-35 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
Pfam:CAMSAP_CC1 859 917 3.8e-29 PFAM
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114167
SMART Domains Protein: ENSMUSP00000109804
Gene: ENSMUSG00000026933

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121689
Gene: ENSMUSG00000026933
AA Change: S152P

DomainStartEndE-ValueType
Blast:Beach 40 100 5e-6 BLAST
Pfam:CAMSAP_CH 170 253 1.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134882
SMART Domains Protein: ENSMUSP00000117203
Gene: ENSMUSG00000026933

DomainStartEndE-ValueType
Pfam:CH 185 350 1.3e-33 PFAM
Pfam:CAMSAP_CH 248 331 2.6e-34 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
coiled coil region 889 925 N/A INTRINSIC
coiled coil region 1030 1057 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139937
Predicted Effect probably benign
Transcript: ENSMUST00000142028
SMART Domains Protein: ENSMUSP00000119296
Gene: ENSMUSG00000026933

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 101 164 7.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143977
Predicted Effect probably benign
Transcript: ENSMUST00000151593
SMART Domains Protein: ENSMUSP00000123541
Gene: ENSMUSG00000026933

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 88 171 5.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183461
SMART Domains Protein: ENSMUSP00000139028
Gene: ENSMUSG00000026933

DomainStartEndE-ValueType
Pfam:CH 185 330 5.4e-34 PFAM
Pfam:CAMSAP_CH 228 311 2.3e-34 PFAM
low complexity region 732 747 N/A INTRINSIC
low complexity region 792 807 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
coiled coil region 869 905 N/A INTRINSIC
coiled coil region 1010 1037 N/A INTRINSIC
coiled coil region 1267 1336 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1373 1390 N/A INTRINSIC
low complexity region 1429 1439 N/A INTRINSIC
CAMSAP_CKK 1442 1570 3.6e-85 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,628,521 T30A unknown Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca12 A G 1: 71,303,490 Y944H possibly damaging Het
Adgrv1 T C 13: 81,508,768 N2869S probably benign Het
Ank1 C A 8: 23,084,809 Q140K probably damaging Het
Aspm T A 1: 139,457,185 M189K probably benign Het
Atp2b1 G T 10: 99,001,316 R539L possibly damaging Het
Catsperd A T 17: 56,651,821 I276L probably benign Het
Cbarp A G 10: 80,132,027 V460A probably damaging Het
Cdk11b A T 4: 155,639,845 T307S unknown Het
Chfr C T 5: 110,169,190 T643I probably damaging Het
Cnbd1 T C 4: 19,098,156 Q88R probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Dusp27 T C 1: 166,100,186 Q619R probably damaging Het
Ghdc G T 11: 100,770,255 A28D probably damaging Het
Gm5114 T C 7: 39,408,116 H693R possibly damaging Het
Gm8251 T C 1: 44,057,775 I1388V probably benign Het
H2-M1 G T 17: 36,670,339 A268E probably damaging Het
Hsf5 A G 11: 87,638,109 N557D probably benign Het
Ighg2c A G 12: 113,287,395 probably benign Het
Il17ra C A 6: 120,481,294 Q469K possibly damaging Het
Ipo8 T A 6: 148,784,566 N809Y probably benign Het
Klra10 T A 6: 130,279,472 Q73L probably damaging Het
Lamb2 T C 9: 108,479,760 V3A unknown Het
Map3k9 T C 12: 81,780,567 Y103C probably damaging Het
Map4 T C 9: 110,052,961 S298P possibly damaging Het
Mtus2 T A 5: 148,306,641 N1254K probably damaging Het
Nap1l5 T A 6: 58,906,967 M1L probably benign Het
Nfxl1 G A 5: 72,559,298 probably benign Het
Nmd3 T C 3: 69,736,016 I227T probably benign Het
Olfr250 T G 9: 38,367,866 C97G probably damaging Het
Ptchd3 G A 11: 121,841,530 M415I possibly damaging Het
Rab28 A T 5: 41,635,839 S154R possibly damaging Het
Rin1 A G 19: 5,053,707 E567G probably damaging Het
Rrbp1 A C 2: 143,969,516 V806G probably benign Het
Sec63 T A 10: 42,803,905 L326Q probably damaging Het
Serinc2 T C 4: 130,255,522 T296A probably damaging Het
Skint10 G A 4: 112,715,784 L272F probably damaging Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Stag1 A G 9: 100,929,914 Q815R probably benign Het
Stat3 A G 11: 100,889,531 M735T possibly damaging Het
Stat3 A G 11: 100,893,912 I576T probably benign Het
Syne1 T C 10: 5,205,071 K5623E probably benign Het
Tas1r2 T C 4: 139,659,725 V165A possibly damaging Het
Tcaf3 A T 6: 42,596,782 D165E probably benign Het
Tex2 G A 11: 106,567,009 Q532* probably null Het
Utrn T C 10: 12,688,381 E1245G probably damaging Het
Other mutations in Camsap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Camsap1 APN 2 25933623 missense possibly damaging 0.95
IGL01555:Camsap1 APN 2 25939393 missense possibly damaging 0.81
IGL01667:Camsap1 APN 2 25945281 splice site probably benign
IGL02167:Camsap1 APN 2 25934300 missense probably damaging 1.00
IGL02191:Camsap1 APN 2 25929880 missense probably damaging 0.97
IGL02285:Camsap1 APN 2 25929802 missense probably damaging 1.00
IGL02393:Camsap1 APN 2 25938322 missense probably benign 0.10
3-1:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R0631:Camsap1 UTSW 2 25933647 missense probably damaging 0.98
R0828:Camsap1 UTSW 2 25939085 missense probably damaging 1.00
R1434:Camsap1 UTSW 2 25945178 missense probably damaging 1.00
R1687:Camsap1 UTSW 2 25939615 missense probably damaging 1.00
R2027:Camsap1 UTSW 2 25938526 missense possibly damaging 0.51
R2048:Camsap1 UTSW 2 25929743 missense probably benign 0.00
R3732:Camsap1 UTSW 2 25938344 missense probably damaging 1.00
R4437:Camsap1 UTSW 2 25938646 missense possibly damaging 0.89
R4494:Camsap1 UTSW 2 25952758 missense probably damaging 1.00
R4888:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5028:Camsap1 UTSW 2 25944556 missense probably damaging 1.00
R5058:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R5105:Camsap1 UTSW 2 25940929 missense probably damaging 1.00
R5121:Camsap1 UTSW 2 25935550 missense probably benign 0.03
R5153:Camsap1 UTSW 2 25933618 missense probably damaging 1.00
R5323:Camsap1 UTSW 2 25965811 missense probably damaging 0.98
R6043:Camsap1 UTSW 2 25929925 missense probably benign 0.00
R6479:Camsap1 UTSW 2 25935862 missense possibly damaging 0.88
R6502:Camsap1 UTSW 2 25956308 missense probably damaging 1.00
R6571:Camsap1 UTSW 2 25939500 missense possibly damaging 0.89
R7046:Camsap1 UTSW 2 25945189 missense probably damaging 0.99
R7251:Camsap1 UTSW 2 25938886 missense probably damaging 0.99
R8026:Camsap1 UTSW 2 25938202 missense probably benign 0.17
R8133:Camsap1 UTSW 2 25934297 missense probably damaging 0.99
R8152:Camsap1 UTSW 2 25940241 missense probably damaging 1.00
R8158:Camsap1 UTSW 2 25944428 nonsense probably null
R8325:Camsap1 UTSW 2 25939363 missense probably benign 0.01
R8339:Camsap1 UTSW 2 25982805 missense possibly damaging 0.74
R9187:Camsap1 UTSW 2 25930016 missense probably damaging 1.00
R9379:Camsap1 UTSW 2 25956306 missense
R9525:Camsap1 UTSW 2 25953950 missense probably benign
R9526:Camsap1 UTSW 2 25953950 missense probably benign
Z1176:Camsap1 UTSW 2 25936639 missense probably damaging 1.00
Z1176:Camsap1 UTSW 2 25940881 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATGGCATCCCAATGTGC -3'
(R):5'- CCTTCCAGTTAAATTGCCTGG -3'

Sequencing Primer
(F):5'- AGCAGGGCTCATGCTAGAC -3'
(R):5'- CCTTCCAGTTAAATTGCCTGGTGTTG -3'
Posted On 2022-05-16