Incidental Mutation 'R9419:Chfr'
ID 712219
Institutional Source Beutler Lab
Gene Symbol Chfr
Ensembl Gene ENSMUSG00000014668
Gene Name checkpoint with forkhead and ring finger domains
Synonyms RNF116, 5730484M20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock # R9419 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 110135842-110171972 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 110169190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 643 (T643I)
Ref Sequence ENSEMBL: ENSMUSP00000108138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557]
AlphaFold Q810L3
Predicted Effect probably damaging
Transcript: ENSMUST00000014812
AA Change: T642I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: T642I

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 512 3.53e0 SMART
Blast:VWA 593 655 3e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112519
AA Change: T643I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: T643I

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
low complexity region 203 215 N/A INTRINSIC
RING 303 341 2.63e-4 SMART
low complexity region 396 421 N/A INTRINSIC
RING 443 513 3.63e0 SMART
Blast:VWA 594 656 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198066
Predicted Effect probably damaging
Transcript: ENSMUST00000198633
AA Change: T571I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: T571I

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
FHA 37 89 1.09e-6 SMART
RING 231 269 2.63e-4 SMART
low complexity region 324 349 N/A INTRINSIC
RING 371 441 3.63e0 SMART
Blast:VWA 522 584 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199557
SMART Domains Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 44 4e-5 SMART
PDB:1LGQ|B 16 44 1e-10 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,628,521 T30A unknown Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca12 A G 1: 71,303,490 Y944H possibly damaging Het
Adgrv1 T C 13: 81,508,768 N2869S probably benign Het
Ank1 C A 8: 23,084,809 Q140K probably damaging Het
Aspm T A 1: 139,457,185 M189K probably benign Het
Atp2b1 G T 10: 99,001,316 R539L possibly damaging Het
Camsap1 A G 2: 25,955,292 S152P Het
Catsperd A T 17: 56,651,821 I276L probably benign Het
Cbarp A G 10: 80,132,027 V460A probably damaging Het
Cdk11b A T 4: 155,639,845 T307S unknown Het
Cnbd1 T C 4: 19,098,156 Q88R probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Dusp27 T C 1: 166,100,186 Q619R probably damaging Het
Ghdc G T 11: 100,770,255 A28D probably damaging Het
Gm5114 T C 7: 39,408,116 H693R possibly damaging Het
Gm8251 T C 1: 44,057,775 I1388V probably benign Het
H2-M1 G T 17: 36,670,339 A268E probably damaging Het
Hsf5 A G 11: 87,638,109 N557D probably benign Het
Ighg2c A G 12: 113,287,395 probably benign Het
Il17ra C A 6: 120,481,294 Q469K possibly damaging Het
Ipo8 T A 6: 148,784,566 N809Y probably benign Het
Klra10 T A 6: 130,279,472 Q73L probably damaging Het
Lamb2 T C 9: 108,479,760 V3A unknown Het
Map3k9 T C 12: 81,780,567 Y103C probably damaging Het
Map4 T C 9: 110,052,961 S298P possibly damaging Het
Mtus2 T A 5: 148,306,641 N1254K probably damaging Het
Nap1l5 T A 6: 58,906,967 M1L probably benign Het
Nfxl1 G A 5: 72,559,298 probably benign Het
Nmd3 T C 3: 69,736,016 I227T probably benign Het
Olfr250 T G 9: 38,367,866 C97G probably damaging Het
Ptchd3 G A 11: 121,841,530 M415I possibly damaging Het
Rab28 A T 5: 41,635,839 S154R possibly damaging Het
Rin1 A G 19: 5,053,707 E567G probably damaging Het
Rrbp1 A C 2: 143,969,516 V806G probably benign Het
Sec63 T A 10: 42,803,905 L326Q probably damaging Het
Serinc2 T C 4: 130,255,522 T296A probably damaging Het
Skint10 G A 4: 112,715,784 L272F probably damaging Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Stag1 A G 9: 100,929,914 Q815R probably benign Het
Stat3 A G 11: 100,889,531 M735T possibly damaging Het
Stat3 A G 11: 100,893,912 I576T probably benign Het
Syne1 T C 10: 5,205,071 K5623E probably benign Het
Tas1r2 T C 4: 139,659,725 V165A possibly damaging Het
Tcaf3 A T 6: 42,596,782 D165E probably benign Het
Tex2 G A 11: 106,567,009 Q532* probably null Het
Utrn T C 10: 12,688,381 E1245G probably damaging Het
Other mutations in Chfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Chfr APN 5 110143573 missense possibly damaging 0.94
IGL01479:Chfr APN 5 110144993 unclassified probably benign
IGL02543:Chfr APN 5 110143547 splice site probably null
IGL02657:Chfr APN 5 110154839 missense probably damaging 1.00
IGL03057:Chfr APN 5 110143609 missense probably benign 0.14
PIT4445001:Chfr UTSW 5 110151677 missense possibly damaging 0.88
R0938:Chfr UTSW 5 110164058 missense probably damaging 1.00
R1346:Chfr UTSW 5 110140447 missense probably damaging 1.00
R1561:Chfr UTSW 5 110158808 missense probably benign 0.05
R1602:Chfr UTSW 5 110151665 missense probably benign 0.26
R1658:Chfr UTSW 5 110153169 missense probably damaging 1.00
R2134:Chfr UTSW 5 110144761 splice site probably null
R2234:Chfr UTSW 5 110170863 missense probably damaging 1.00
R4371:Chfr UTSW 5 110136168 missense probably damaging 0.99
R4420:Chfr UTSW 5 110170880 nonsense probably null
R4666:Chfr UTSW 5 110144867 nonsense probably null
R4742:Chfr UTSW 5 110143598 missense probably benign 0.04
R4809:Chfr UTSW 5 110158834 missense probably damaging 1.00
R5490:Chfr UTSW 5 110153129 missense possibly damaging 0.88
R5581:Chfr UTSW 5 110153282 critical splice donor site probably null
R5820:Chfr UTSW 5 110162739 missense possibly damaging 0.94
R6012:Chfr UTSW 5 110144651 critical splice donor site probably null
R7128:Chfr UTSW 5 110143636 missense probably benign 0.33
R7166:Chfr UTSW 5 110158805 missense probably benign
R7278:Chfr UTSW 5 110140360 missense probably benign 0.23
R7393:Chfr UTSW 5 110152358 missense probably damaging 0.98
R7422:Chfr UTSW 5 110162705 splice site probably null
R7499:Chfr UTSW 5 110151683 missense probably benign 0.40
R8224:Chfr UTSW 5 110160243 critical splice donor site probably null
R8264:Chfr UTSW 5 110152434 missense possibly damaging 0.86
R8325:Chfr UTSW 5 110162763 nonsense probably null
R8333:Chfr UTSW 5 110154937 missense probably benign 0.05
R8823:Chfr UTSW 5 110152392 missense probably damaging 0.96
R9024:Chfr UTSW 5 110158832 missense probably benign 0.26
X0013:Chfr UTSW 5 110151579 missense probably benign 0.19
Z1176:Chfr UTSW 5 110144895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTACGTGGCAACTTATCTGAC -3'
(R):5'- TGAAGCCAGAACTTTGCATTTC -3'

Sequencing Primer
(F):5'- AAGCAGATCCCTAGGTTTGC -3'
(R):5'- AGCCAGAACTTTGCATTTCTACTAC -3'
Posted On 2022-05-16