Incidental Mutation 'R9419:Tcaf3'
ID 712221
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R9419 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42584866-42597692 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42596782 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 165 (D165E)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably benign
Transcript: ENSMUST00000069023
AA Change: D165E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: D165E

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
AA Change: D165E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: D165E

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700064H15Rik T C 3: 19,628,521 T30A unknown Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca12 A G 1: 71,303,490 Y944H possibly damaging Het
Adgrv1 T C 13: 81,508,768 N2869S probably benign Het
Ank1 C A 8: 23,084,809 Q140K probably damaging Het
Aspm T A 1: 139,457,185 M189K probably benign Het
Atp2b1 G T 10: 99,001,316 R539L possibly damaging Het
Camsap1 A G 2: 25,955,292 S152P Het
Catsperd A T 17: 56,651,821 I276L probably benign Het
Cbarp A G 10: 80,132,027 V460A probably damaging Het
Cd40 A T 2: 165,062,242 probably benign Het
Cdk11b A T 4: 155,639,845 T307S unknown Het
Chfr C T 5: 110,169,190 T643I probably damaging Het
Cnbd1 T C 4: 19,098,156 Q88R probably benign Het
Col15a1 G C 4: 47,288,200 probably benign Het
Dusp27 T C 1: 166,100,186 Q619R probably damaging Het
Ghdc G T 11: 100,770,255 A28D probably damaging Het
Gm5114 T C 7: 39,408,116 H693R possibly damaging Het
Gm8251 T C 1: 44,057,775 I1388V probably benign Het
H2-M1 G T 17: 36,670,339 A268E probably damaging Het
Hsf5 A G 11: 87,638,109 N557D probably benign Het
Ighg2c A G 12: 113,287,395 probably benign Het
Il17ra C A 6: 120,481,294 Q469K possibly damaging Het
Ipo8 T A 6: 148,784,566 N809Y probably benign Het
Klra10 T A 6: 130,279,472 Q73L probably damaging Het
Lamb2 T C 9: 108,479,760 V3A unknown Het
Map3k9 T C 12: 81,780,567 Y103C probably damaging Het
Map4 T C 9: 110,052,961 S298P possibly damaging Het
Mtus2 T A 5: 148,306,641 N1254K probably damaging Het
Nap1l5 T A 6: 58,906,967 M1L probably benign Het
Nfxl1 G A 5: 72,559,298 probably benign Het
Nmd3 T C 3: 69,736,016 I227T probably benign Het
Olfr250 T G 9: 38,367,866 C97G probably damaging Het
Ptchd3 G A 11: 121,841,530 M415I possibly damaging Het
Rab28 A T 5: 41,635,839 S154R possibly damaging Het
Rin1 A G 19: 5,053,707 E567G probably damaging Het
Rrbp1 A C 2: 143,969,516 V806G probably benign Het
Sec63 T A 10: 42,803,905 L326Q probably damaging Het
Serinc2 T C 4: 130,255,522 T296A probably damaging Het
Skint10 G A 4: 112,715,784 L272F probably damaging Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Stag1 A G 9: 100,929,914 Q815R probably benign Het
Stat3 A G 11: 100,889,531 M735T possibly damaging Het
Stat3 A G 11: 100,893,912 I576T probably benign Het
Syne1 T C 10: 5,205,071 K5623E probably benign Het
Tas1r2 T C 4: 139,659,725 V165A possibly damaging Het
Tex2 G A 11: 106,567,009 Q532* probably null Het
Utrn T C 10: 12,688,381 E1245G probably damaging Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42593385 missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42597228 missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42593681 missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42597129 missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42596660 missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42593898 missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42589839 missense probably damaging 1.00
defused UTSW 6 42596933 missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42591350 missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42589758 missense probably benign
R0357:Tcaf3 UTSW 6 42589827 missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42596843 missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42591434 missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42593552 missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42596688 missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42593724 missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42593328 missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42591430 missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42593729 missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42594044 missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42593853 missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42589804 missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42597080 missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42589996 missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42587579 missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42593366 splice site probably null
R4904:Tcaf3 UTSW 6 42593997 nonsense probably null
R5030:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42593684 missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42591325 missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42596933 missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42597020 missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42593715 missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42591467 missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42587510 missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42591926 missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42596763 missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42597185 missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42587528 missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42593849 missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42596697 missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42589971 missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42593791 missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42597259 missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42597171 missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42593238 missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42594061 missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42597125 missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42593891 missense probably benign
R7185:Tcaf3 UTSW 6 42593930 missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42593801 missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42589914 missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42596842 missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42597135 missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42594206 splice site probably null
R7909:Tcaf3 UTSW 6 42591964 missense possibly damaging 0.92
R9440:Tcaf3 UTSW 6 42596972 nonsense probably null
R9469:Tcaf3 UTSW 6 42596894 missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42589702 missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42597090 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATCCATGTTAGGCTGAAATCTCC -3'
(R):5'- CCTAGGTGATTCTGGGATAAATGC -3'

Sequencing Primer
(F):5'- GGCTGAAATCTCCTTTTAGAATAGG -3'
(R):5'- GATAAATGCCTTGGTTCAGCC -3'
Posted On 2022-05-16