Incidental Mutation 'R9420:Letm1'
ID 712266
Institutional Source Beutler Lab
Gene Symbol Letm1
Ensembl Gene ENSMUSG00000005299
Gene Name leucine zipper-EF-hand containing transmembrane protein 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock # R9420 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 33739673-33782817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33769458 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 165 (H165R)
Ref Sequence ENSEMBL: ENSMUSP00000005431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431]
AlphaFold Q9Z2I0
Predicted Effect probably damaging
Transcript: ENSMUST00000005431
AA Change: H165R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299
AA Change: H165R

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200827
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037H04Rik T C 2: 131,151,762 probably null Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Aatk A G 11: 120,021,451 I56T probably benign Het
Akr1c12 A G 13: 4,275,797 L99S probably damaging Het
Azin1 C A 15: 38,493,627 V251F possibly damaging Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
C2cd3 A T 7: 100,416,055 M305L Het
Casz1 A G 4: 148,938,863 T742A probably damaging Het
Cbfa2t2 A G 2: 154,510,506 probably null Het
Clec2e T A 6: 129,094,457 Y139F possibly damaging Het
Crisp2 T A 17: 40,783,833 N117I possibly damaging Het
Ddx52 A T 11: 83,942,182 D2V probably damaging Het
Dmpk T A 7: 19,091,021 V442E probably benign Het
Dnah2 A T 11: 69,478,116 M1654K probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Erlec1 A G 11: 30,935,054 V411A probably damaging Het
Fam208a A T 14: 27,441,970 I238F probably damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Fry A G 5: 150,433,529 E1847G possibly damaging Het
Gck A G 11: 5,949,553 probably null Het
Gga2 T C 7: 122,003,972 D167G probably damaging Het
Gprc6a A G 10: 51,615,410 S748P probably damaging Het
H2-M10.2 T C 17: 36,284,751 R216G probably benign Het
H2-M2 T A 17: 37,481,324 I312F probably benign Het
Havcr2 A T 11: 46,456,523 Y109F probably damaging Het
Hoga1 T C 19: 42,059,894 V67A Het
Kcnk12 C A 17: 87,797,079 V126L possibly damaging Het
Klc1 A G 12: 111,772,516 E66G probably damaging Het
Klhl2 A T 8: 64,752,836 Y350* probably null Het
Luc7l2 T C 6: 38,570,554 C36R probably damaging Het
Mab21l1 A G 3: 55,783,253 N87S probably damaging Het
Mdn1 A G 4: 32,678,414 T681A probably damaging Het
Mrc1 C T 2: 14,307,979 T904I possibly damaging Het
Mrpl38 A G 11: 116,132,450 S326P probably damaging Het
Mtr T G 13: 12,253,878 K32N probably benign Het
Mybpc3 T A 2: 91,135,133 C1128* probably null Het
Ncdn T C 4: 126,751,969 D49G probably damaging Het
Nfkbiz G A 16: 55,821,974 T27I probably damaging Het
Npnt A T 3: 132,948,105 Y38* probably null Het
Nrxn2 A G 19: 6,531,901 E1622G probably benign Het
Nutm2 T C 13: 50,472,928 I373T probably damaging Het
Olfr48 T C 2: 89,844,371 I201V probably benign Het
Olfr631 T C 7: 103,929,773 S317P possibly damaging Het
Osbp2 A G 11: 3,712,170 S228P probably damaging Het
Pbx3 C T 2: 34,213,336 R208Q probably damaging Het
Pcdhgb5 T C 18: 37,731,785 V211A probably benign Het
Pi16 C T 17: 29,325,925 T151M probably damaging Het
Ptpro T C 6: 137,443,935 I1068T probably benign Het
Rbl1 A T 2: 157,193,234 Y309N probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,927 probably benign Het
Serpina3g G C 12: 104,240,259 E106D probably benign Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Son G C 16: 91,657,620 R1085P probably damaging Het
Tbx18 C A 9: 87,730,622 A75S probably benign Het
Tmem232 C A 17: 65,485,886 Q105H probably damaging Het
Ttc29 A G 8: 78,333,761 I437V probably benign Het
Ttc30b T A 2: 75,938,047 I121F possibly damaging Het
Ttn T A 2: 76,791,543 I15552L probably damaging Het
Ttn T A 2: 76,919,969 T3579S probably benign Het
Vps11 A G 9: 44,356,422 F298L probably benign Het
Wbp11 T C 6: 136,814,261 T625A unknown Het
Xylb T A 9: 119,386,362 N460K probably damaging Het
Znrf4 C A 17: 56,512,218 V30F probably damaging Het
Other mutations in Letm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Letm1 APN 5 33762590 missense possibly damaging 0.82
IGL01073:Letm1 APN 5 33748800 missense possibly damaging 0.89
IGL01882:Letm1 APN 5 33769665 missense probably benign 0.00
IGL02186:Letm1 APN 5 33745047 missense probably benign 0.00
IGL02699:Letm1 APN 5 33745148 missense possibly damaging 0.93
IGL03089:Letm1 APN 5 33760858 missense probably damaging 1.00
R0466:Letm1 UTSW 5 33761730 splice site probably benign
R0639:Letm1 UTSW 5 33769426 missense possibly damaging 0.88
R1370:Letm1 UTSW 5 33778682 splice site probably null
R1415:Letm1 UTSW 5 33769562 missense probably benign 0.06
R1511:Letm1 UTSW 5 33752555 missense probably damaging 1.00
R1714:Letm1 UTSW 5 33760884 missense possibly damaging 0.51
R1771:Letm1 UTSW 5 33769467 missense probably damaging 1.00
R1990:Letm1 UTSW 5 33769515 frame shift probably null
R1991:Letm1 UTSW 5 33769515 frame shift probably null
R2143:Letm1 UTSW 5 33769515 frame shift probably null
R2145:Letm1 UTSW 5 33769515 frame shift probably null
R2202:Letm1 UTSW 5 33769486 missense possibly damaging 0.64
R2290:Letm1 UTSW 5 33769515 frame shift probably null
R2292:Letm1 UTSW 5 33769515 frame shift probably null
R5574:Letm1 UTSW 5 33769386 missense possibly damaging 0.46
R6954:Letm1 UTSW 5 33782507 missense probably benign 0.35
R7265:Letm1 UTSW 5 33778648 missense possibly damaging 0.62
R8713:Letm1 UTSW 5 33762505 missense probably damaging 1.00
R9028:Letm1 UTSW 5 33752503 missense probably damaging 1.00
R9061:Letm1 UTSW 5 33760869 missense probably damaging 1.00
S24628:Letm1 UTSW 5 33747444 missense probably benign 0.00
S24628:Letm1 UTSW 5 33747446 missense probably benign
X0066:Letm1 UTSW 5 33762571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCACTGGCATGACAACTC -3'
(R):5'- GCACTCATCATCTCCGCTAG -3'

Sequencing Primer
(F):5'- GGCATGACAACTCACTTGTAGCATG -3'
(R):5'- TCCGCTAGGAGAGGACTCTGTG -3'
Posted On 2022-05-16