Incidental Mutation 'R9420:Gprc6a'
ID 712285
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9420 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51491506 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 748 (S748P)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably damaging
Transcript: ENSMUST00000020062
AA Change: S748P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: S748P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218684
AA Change: S573P

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000219286
AA Change: S677P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 119,912,277 (GRCm39) I56T probably benign Het
Adissp T C 2: 130,993,682 (GRCm39) probably null Het
Akr1c12 A G 13: 4,325,796 (GRCm39) L99S probably damaging Het
Azin1 C A 15: 38,493,871 (GRCm39) V251F possibly damaging Het
Btbd16 C T 7: 130,417,516 (GRCm39) R344C probably damaging Het
C2cd3 A T 7: 100,065,262 (GRCm39) M305L Het
Casz1 A G 4: 149,023,320 (GRCm39) T742A probably damaging Het
Cbfa2t2 A G 2: 154,352,426 (GRCm39) probably null Het
Clec2e T A 6: 129,071,420 (GRCm39) Y139F possibly damaging Het
Crisp2 T A 17: 41,094,724 (GRCm39) N117I possibly damaging Het
Ddx52 A T 11: 83,833,008 (GRCm39) D2V probably damaging Het
Dmpk T A 7: 18,824,946 (GRCm39) V442E probably benign Het
Dnah2 A T 11: 69,368,942 (GRCm39) M1654K probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,739,935 (GRCm39) probably benign Het
Erlec1 A G 11: 30,885,054 (GRCm39) V411A probably damaging Het
Fktn G A 4: 53,734,854 (GRCm39) G125D probably benign Het
Fry A G 5: 150,356,994 (GRCm39) E1847G possibly damaging Het
Gck A G 11: 5,899,553 (GRCm39) probably null Het
Gga2 T C 7: 121,603,195 (GRCm39) D167G probably damaging Het
H2-M10.2 T C 17: 36,595,643 (GRCm39) R216G probably benign Het
H2-M2 T A 17: 37,792,215 (GRCm39) I312F probably benign Het
Havcr2 A T 11: 46,347,350 (GRCm39) Y109F probably damaging Het
Hoga1 T C 19: 42,048,333 (GRCm39) V67A Het
Ift70b T A 2: 75,768,391 (GRCm39) I121F possibly damaging Het
Kcnk12 C A 17: 88,104,507 (GRCm39) V126L possibly damaging Het
Klc1 A G 12: 111,738,950 (GRCm39) E66G probably damaging Het
Klhl2 A T 8: 65,205,870 (GRCm39) Y350* probably null Het
Letm1 T C 5: 33,926,802 (GRCm39) H165R probably damaging Het
Luc7l2 T C 6: 38,547,489 (GRCm39) C36R probably damaging Het
Mab21l1 A G 3: 55,690,674 (GRCm39) N87S probably damaging Het
Mdn1 A G 4: 32,678,414 (GRCm39) T681A probably damaging Het
Mrc1 C T 2: 14,312,790 (GRCm39) T904I possibly damaging Het
Mrpl38 A G 11: 116,023,276 (GRCm39) S326P probably damaging Het
Mtr T G 13: 12,268,764 (GRCm39) K32N probably benign Het
Mybpc3 T A 2: 90,965,478 (GRCm39) C1128* probably null Het
Ncdn T C 4: 126,645,762 (GRCm39) D49G probably damaging Het
Nfkbiz G A 16: 55,642,337 (GRCm39) T27I probably damaging Het
Npnt A T 3: 132,653,866 (GRCm39) Y38* probably null Het
Nrxn2 A G 19: 6,581,931 (GRCm39) E1622G probably benign Het
Nutm2 T C 13: 50,626,964 (GRCm39) I373T probably damaging Het
Or4c58 T C 2: 89,674,715 (GRCm39) I201V probably benign Het
Or51m1 T C 7: 103,578,980 (GRCm39) S317P possibly damaging Het
Osbp2 A G 11: 3,662,170 (GRCm39) S228P probably damaging Het
Pbx3 C T 2: 34,103,348 (GRCm39) R208Q probably damaging Het
Pcdhgb5 T C 18: 37,864,838 (GRCm39) V211A probably benign Het
Pi16 C T 17: 29,544,899 (GRCm39) T151M probably damaging Het
Pramel39-ps G T 5: 94,451,001 (GRCm39) P375H probably damaging Het
Ptpro T C 6: 137,420,933 (GRCm39) I1068T probably benign Het
Rbl1 A T 2: 157,035,154 (GRCm39) Y309N probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,229,134 (GRCm39) probably benign Het
Serpina3g G C 12: 104,206,518 (GRCm39) E106D probably benign Het
Slc4a11 C T 2: 130,533,664 (GRCm39) A100T probably damaging Het
Son G C 16: 91,454,508 (GRCm39) R1085P probably damaging Het
Tasor A T 14: 27,163,927 (GRCm39) I238F probably damaging Het
Tbx18 C A 9: 87,612,675 (GRCm39) A75S probably benign Het
Tmem232 C A 17: 65,792,881 (GRCm39) Q105H probably damaging Het
Ttc29 A G 8: 79,060,390 (GRCm39) I437V probably benign Het
Ttn T A 2: 76,621,887 (GRCm39) I15552L probably damaging Het
Ttn T A 2: 76,750,313 (GRCm39) T3579S probably benign Het
Vps11 A G 9: 44,267,719 (GRCm39) F298L probably benign Het
Wbp11 T C 6: 136,791,259 (GRCm39) T625A unknown Het
Xylb T A 9: 119,215,428 (GRCm39) N460K probably damaging Het
Znrf4 C A 17: 56,819,218 (GRCm39) V30F probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7736:Gprc6a UTSW 10 51,491,549 (GRCm39) missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTATAATCTCCACGGCGGG -3'
(R):5'- TAGCTTTCAGTTTTGACCCCAAG -3'

Sequencing Primer
(F):5'- ACTTGCCGAATGTGGTAGTATAGAC -3'
(R):5'- CCAAGCTGACAATGTTCCTGAAGTG -3'
Posted On 2022-05-16