Incidental Mutation 'R9420:Gprc6a'
ID 712285
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
Accession Numbers

Ncbi RefSeq: NM_153071.1; MGI:2429498

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9420 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51614823-51631461 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 51615410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 748 (S748P)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect probably damaging
Transcript: ENSMUST00000020062
AA Change: S748P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: S748P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218684
AA Change: S573P

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000219286
AA Change: S677P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype Strain: 3831176
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037H04Rik T C 2: 131,151,762 probably null Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Aatk A G 11: 120,021,451 I56T probably benign Het
Akr1c12 A G 13: 4,275,797 L99S probably damaging Het
Azin1 C A 15: 38,493,627 V251F possibly damaging Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
C2cd3 A T 7: 100,416,055 M305L Het
Casz1 A G 4: 148,938,863 T742A probably damaging Het
Cbfa2t2 A G 2: 154,510,506 probably null Het
Clec2e T A 6: 129,094,457 Y139F possibly damaging Het
Crisp2 T A 17: 40,783,833 N117I possibly damaging Het
Ddx52 A T 11: 83,942,182 D2V probably damaging Het
Dmpk T A 7: 19,091,021 V442E probably benign Het
Dnah2 A T 11: 69,478,116 M1654K probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Erlec1 A G 11: 30,935,054 V411A probably damaging Het
Fam208a A T 14: 27,441,970 I238F probably damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Fry A G 5: 150,433,529 E1847G possibly damaging Het
Gck A G 11: 5,949,553 probably null Het
Gga2 T C 7: 122,003,972 D167G probably damaging Het
H2-M10.2 T C 17: 36,284,751 R216G probably benign Het
H2-M2 T A 17: 37,481,324 I312F probably benign Het
Havcr2 A T 11: 46,456,523 Y109F probably damaging Het
Hoga1 T C 19: 42,059,894 V67A Het
Kcnk12 C A 17: 87,797,079 V126L possibly damaging Het
Klc1 A G 12: 111,772,516 E66G probably damaging Het
Klhl2 A T 8: 64,752,836 Y350* probably null Het
Letm1 T C 5: 33,769,458 H165R probably damaging Het
Luc7l2 T C 6: 38,570,554 C36R probably damaging Het
Mab21l1 A G 3: 55,783,253 N87S probably damaging Het
Mdn1 A G 4: 32,678,414 T681A probably damaging Het
Mrc1 C T 2: 14,307,979 T904I possibly damaging Het
Mrpl38 A G 11: 116,132,450 S326P probably damaging Het
Mtr T G 13: 12,253,878 K32N probably benign Het
Mybpc3 T A 2: 91,135,133 C1128* probably null Het
Ncdn T C 4: 126,751,969 D49G probably damaging Het
Nfkbiz G A 16: 55,821,974 T27I probably damaging Het
Npnt A T 3: 132,948,105 Y38* probably null Het
Nrxn2 A G 19: 6,531,901 E1622G probably benign Het
Nutm2 T C 13: 50,472,928 I373T probably damaging Het
Olfr48 T C 2: 89,844,371 I201V probably benign Het
Olfr631 T C 7: 103,929,773 S317P possibly damaging Het
Osbp2 A G 11: 3,712,170 S228P probably damaging Het
Pbx3 C T 2: 34,213,336 R208Q probably damaging Het
Pcdhgb5 T C 18: 37,731,785 V211A probably benign Het
Pi16 C T 17: 29,325,925 T151M probably damaging Het
Ptpro T C 6: 137,443,935 I1068T probably benign Het
Rbl1 A T 2: 157,193,234 Y309N probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,927 probably benign Het
Serpina3g G C 12: 104,240,259 E106D probably benign Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Son G C 16: 91,657,620 R1085P probably damaging Het
Tbx18 C A 9: 87,730,622 A75S probably benign Het
Tmem232 C A 17: 65,485,886 Q105H probably damaging Het
Ttc29 A G 8: 78,333,761 I437V probably benign Het
Ttc30b T A 2: 75,938,047 I121F possibly damaging Het
Ttn T A 2: 76,791,543 I15552L probably damaging Het
Ttn T A 2: 76,919,969 T3579S probably benign Het
Vps11 A G 9: 44,356,422 F298L probably benign Het
Wbp11 T C 6: 136,814,261 T625A unknown Het
Xylb T A 9: 119,386,362 N460K probably damaging Het
Znrf4 C A 17: 56,512,218 V30F probably damaging Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51615430 missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51627084 missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51626723 missense probably benign
IGL02317:Gprc6a APN 10 51620953 missense probably benign 0.01
IGL02995:Gprc6a APN 10 51626799 missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51616603 missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51628349 missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51615872 missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51615259 missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0040:Gprc6a UTSW 10 51614984 nonsense probably null
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51615389 missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51628437 missense probably benign 0.01
R1831:Gprc6a UTSW 10 51615806 missense probably benign 0.22
R2108:Gprc6a UTSW 10 51615208 missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51615680 frame shift probably null
R2160:Gprc6a UTSW 10 51615680 frame shift probably null
R2162:Gprc6a UTSW 10 51615680 frame shift probably null
R2229:Gprc6a UTSW 10 51626795 missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51628296 missense probably benign 0.02
R3709:Gprc6a UTSW 10 51615680 frame shift probably null
R3710:Gprc6a UTSW 10 51615680 frame shift probably null
R3737:Gprc6a UTSW 10 51626911 missense probably benign
R3914:Gprc6a UTSW 10 51628275 missense probably benign 0.00
R3918:Gprc6a UTSW 10 51615680 frame shift probably null
R3964:Gprc6a UTSW 10 51615680 frame shift probably null
R3965:Gprc6a UTSW 10 51615680 frame shift probably null
R3966:Gprc6a UTSW 10 51615680 frame shift probably null
R3973:Gprc6a UTSW 10 51628448 missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3978:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R3979:Gprc6a UTSW 10 51621101 missense probably benign 0.18
R4306:Gprc6a UTSW 10 51616639 missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4405:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4408:Gprc6a UTSW 10 51628543 missense probably benign 0.09
R4713:Gprc6a UTSW 10 51631457 unclassified probably benign
R4788:Gprc6a UTSW 10 51615008 missense probably benign 0.00
R5248:Gprc6a UTSW 10 51614993 missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51626804 missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51626702 missense probably benign
R5721:Gprc6a UTSW 10 51614980 missense probably benign 0.06
R6061:Gprc6a UTSW 10 51615811 missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51615077 missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51615260 missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51614912 missense probably benign 0.44
R6207:Gprc6a UTSW 10 51626835 missense probably benign 0.36
R6497:Gprc6a UTSW 10 51615701 missense probably benign 0.05
R6717:Gprc6a UTSW 10 51615137 missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51631316 missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51626745 nonsense probably null
R7000:Gprc6a UTSW 10 51615047 missense probably benign 0.34
R7019:Gprc6a UTSW 10 51631412 missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51614890 missense probably benign
R7173:Gprc6a UTSW 10 51628499 missense probably benign 0.01
R7579:Gprc6a UTSW 10 51626787 missense probably benign
R7736:Gprc6a UTSW 10 51615453 missense possibly damaging 0.82
R7920:Gprc6a UTSW 10 51614930 missense probably benign 0.02
R8273:Gprc6a UTSW 10 51631274 missense probably benign
R8329:Gprc6a UTSW 10 51627259 nonsense probably null
R8517:Gprc6a UTSW 10 51631241 missense probably benign 0.00
R8723:Gprc6a UTSW 10 51615422 missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51620983 missense probably benign 0.00
R8829:Gprc6a UTSW 10 51615199 missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51621086 missense possibly damaging 0.94
R9753:Gprc6a UTSW 10 51628268 missense probably benign 0.20
R9766:Gprc6a UTSW 10 51615788 missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51615299 missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51615209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTATAATCTCCACGGCGGG -3'
(R):5'- TAGCTTTCAGTTTTGACCCCAAG -3'

Sequencing Primer
(F):5'- ACTTGCCGAATGTGGTAGTATAGAC -3'
(R):5'- CCAAGCTGACAATGTTCCTGAAGTG -3'
Posted On 2022-05-16