Incidental Mutation 'R9420:H2-M2'
ID 712305
Institutional Source Beutler Lab
Gene Symbol H2-M2
Ensembl Gene ENSMUSG00000016283
Gene Name histocompatibility 2, M region locus 2
Synonyms Thy19.4, H-2M2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R9420 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37480851-37483552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37481324 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 312 (I312F)
Ref Sequence ENSEMBL: ENSMUSP00000131297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016427] [ENSMUST00000171139]
AlphaFold Q6W9L1
Predicted Effect probably benign
Transcript: ENSMUST00000016427
SMART Domains Protein: ENSMUSP00000016427
Gene: ENSMUSG00000016283

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 1.6e-77 PFAM
IGc1 226 297 2.11e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171139
AA Change: I312F

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131297
Gene: ENSMUSG00000016283
AA Change: I312F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 7.1e-76 PFAM
IGc1 226 297 2.11e-20 SMART
transmembrane domain 308 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037H04Rik T C 2: 131,151,762 probably null Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Aatk A G 11: 120,021,451 I56T probably benign Het
Akr1c12 A G 13: 4,275,797 L99S probably damaging Het
Azin1 C A 15: 38,493,627 V251F possibly damaging Het
Btbd16 C T 7: 130,815,786 R344C probably damaging Het
C2cd3 A T 7: 100,416,055 M305L Het
Casz1 A G 4: 148,938,863 T742A probably damaging Het
Cbfa2t2 A G 2: 154,510,506 probably null Het
Clec2e T A 6: 129,094,457 Y139F possibly damaging Het
Crisp2 T A 17: 40,783,833 N117I possibly damaging Het
Ddx52 A T 11: 83,942,182 D2V probably damaging Het
Dmpk T A 7: 19,091,021 V442E probably benign Het
Dnah2 A T 11: 69,478,116 M1654K probably benign Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Erlec1 A G 11: 30,935,054 V411A probably damaging Het
Fam208a A T 14: 27,441,970 I238F probably damaging Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Fry A G 5: 150,433,529 E1847G possibly damaging Het
Gck A G 11: 5,949,553 probably null Het
Gga2 T C 7: 122,003,972 D167G probably damaging Het
Gprc6a A G 10: 51,615,410 S748P probably damaging Het
H2-M10.2 T C 17: 36,284,751 R216G probably benign Het
Havcr2 A T 11: 46,456,523 Y109F probably damaging Het
Hoga1 T C 19: 42,059,894 V67A Het
Kcnk12 C A 17: 87,797,079 V126L possibly damaging Het
Klc1 A G 12: 111,772,516 E66G probably damaging Het
Klhl2 A T 8: 64,752,836 Y350* probably null Het
Letm1 T C 5: 33,769,458 H165R probably damaging Het
Luc7l2 T C 6: 38,570,554 C36R probably damaging Het
Mab21l1 A G 3: 55,783,253 N87S probably damaging Het
Mdn1 A G 4: 32,678,414 T681A probably damaging Het
Mrc1 C T 2: 14,307,979 T904I possibly damaging Het
Mrpl38 A G 11: 116,132,450 S326P probably damaging Het
Mtr T G 13: 12,253,878 K32N probably benign Het
Mybpc3 T A 2: 91,135,133 C1128* probably null Het
Ncdn T C 4: 126,751,969 D49G probably damaging Het
Nfkbiz G A 16: 55,821,974 T27I probably damaging Het
Npnt A T 3: 132,948,105 Y38* probably null Het
Nrxn2 A G 19: 6,531,901 E1622G probably benign Het
Nutm2 T C 13: 50,472,928 I373T probably damaging Het
Olfr48 T C 2: 89,844,371 I201V probably benign Het
Olfr631 T C 7: 103,929,773 S317P possibly damaging Het
Osbp2 A G 11: 3,712,170 S228P probably damaging Het
Pbx3 C T 2: 34,213,336 R208Q probably damaging Het
Pcdhgb5 T C 18: 37,731,785 V211A probably benign Het
Pi16 C T 17: 29,325,925 T151M probably damaging Het
Ptpro T C 6: 137,443,935 I1068T probably benign Het
Rbl1 A T 2: 157,193,234 Y309N probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,927 probably benign Het
Serpina3g G C 12: 104,240,259 E106D probably benign Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Son G C 16: 91,657,620 R1085P probably damaging Het
Tbx18 C A 9: 87,730,622 A75S probably benign Het
Tmem232 C A 17: 65,485,886 Q105H probably damaging Het
Ttc29 A G 8: 78,333,761 I437V probably benign Het
Ttc30b T A 2: 75,938,047 I121F possibly damaging Het
Ttn T A 2: 76,791,543 I15552L probably damaging Het
Ttn T A 2: 76,919,969 T3579S probably benign Het
Vps11 A G 9: 44,356,422 F298L probably benign Het
Wbp11 T C 6: 136,814,261 T625A unknown Het
Xylb T A 9: 119,386,362 N460K probably damaging Het
Znrf4 C A 17: 56,512,218 V30F probably damaging Het
Other mutations in H2-M2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01683:H2-M2 APN 17 37481515 missense possibly damaging 0.95
Lock UTSW 17 37481508 missense probably damaging 1.00
Nokia UTSW 17 37481306 missense possibly damaging 0.59
R0799:H2-M2 UTSW 17 37482749 missense probably damaging 1.00
R0981:H2-M2 UTSW 17 37482630 missense probably benign 0.02
R1925:H2-M2 UTSW 17 37482500 missense probably damaging 0.98
R2959:H2-M2 UTSW 17 37483454 missense probably benign 0.20
R3968:H2-M2 UTSW 17 37481306 missense possibly damaging 0.59
R4063:H2-M2 UTSW 17 37481508 missense probably damaging 1.00
R4735:H2-M2 UTSW 17 37483244 missense possibly damaging 0.91
R5806:H2-M2 UTSW 17 37481726 missense probably damaging 1.00
R6410:H2-M2 UTSW 17 37483213 missense probably damaging 1.00
R7432:H2-M2 UTSW 17 37481470 critical splice donor site probably null
R7456:H2-M2 UTSW 17 37481661 missense possibly damaging 0.60
R7535:H2-M2 UTSW 17 37482637 missense probably benign 0.07
R7680:H2-M2 UTSW 17 37483025 missense possibly damaging 0.56
R8112:H2-M2 UTSW 17 37483492 missense unknown
R8910:H2-M2 UTSW 17 37481522 missense probably damaging 1.00
R9034:H2-M2 UTSW 17 37481285 missense probably benign 0.05
R9193:H2-M2 UTSW 17 37482537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAATGGGCCACACTCCTTC -3'
(R):5'- TTCTGGGAAGGAGCAGAATTAC -3'

Sequencing Primer
(F):5'- CTTCCCAACAAGGAGGCAGAG -3'
(R):5'- TCATGAGGGACTGCCTGAG -3'
Posted On 2022-05-16