Incidental Mutation 'R9422:Olfr855'
ID 712386
Institutional Source Beutler Lab
Gene Symbol Olfr855
Ensembl Gene ENSMUSG00000043087
Gene Name olfactory receptor 855
Synonyms MOR148-1, GA_x6K02T2PVTD-13330461-13331399
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R9422 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 19582617-19586030 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19584672 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 45 (I45K)
Ref Sequence ENSEMBL: ENSMUSP00000150218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061693] [ENSMUST00000215587]
AlphaFold Q7TRF8
Predicted Effect probably damaging
Transcript: ENSMUST00000061693
AA Change: I45K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054790
Gene: ENSMUSG00000043087
AA Change: I45K

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.7e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 182 5.2e-8 PFAM
Pfam:7tm_1 43 292 2.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215587
AA Change: I45K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,849,289 V209I Het
Adamts18 T A 8: 113,775,278 Y317F probably damaging Het
Adgrg6 C T 10: 14,426,996 R863H probably damaging Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Ank2 C A 3: 127,096,856 K55N unknown Het
B3galnt2 A G 13: 13,975,551 T160A probably benign Het
Becn1 C A 11: 101,302,006 probably benign Het
Ccdc151 T A 9: 22,002,332 H48L possibly damaging Het
Ccdc57 T C 11: 120,873,618 N777S possibly damaging Het
Cd302 T C 2: 60,252,353 Y209C probably damaging Het
Cfap69 A G 5: 5,649,851 V63A probably benign Het
Clasp1 T A 1: 118,462,527 I147N possibly damaging Het
Cmtm3 A T 8: 104,340,726 probably benign Het
Cmtm3 G T 8: 104,340,727 probably benign Het
Col15a1 A T 4: 47,293,364 probably null Het
Csn3 A G 5: 87,930,013 N126S probably benign Het
Dcp2 C T 18: 44,405,294 R173C probably damaging Het
Dctn1 T A 6: 83,193,709 H729Q possibly damaging Het
Dopey1 C T 9: 86,543,040 H2138Y probably damaging Het
Fbxo2 T C 4: 148,164,159 L36P unknown Het
Gm13088 T A 4: 143,656,412 K79M probably damaging Het
Gzmg T A 14: 56,158,355 Y49F probably benign Het
Hist1h2bb A G 13: 23,746,957 I55V possibly damaging Het
Hivep1 A G 13: 42,159,737 T1818A probably benign Het
Ipmk T C 10: 71,376,720 S171P possibly damaging Het
Milr1 T A 11: 106,766,979 Y239N probably damaging Het
Muc16 T C 9: 18,641,806 N4397S probably benign Het
Nell1 C A 7: 50,062,639 S69* probably null Het
Nme8 A G 13: 19,675,748 V234A probably benign Het
Notch2 A G 3: 98,147,352 S2444G probably damaging Het
Olfr501-ps1 A T 7: 108,508,948 K297N unknown Het
Pex5l T C 3: 33,082,252 probably benign Het
Pgm3 A T 9: 86,561,885 L322H probably damaging Het
Plxna2 T A 1: 194,644,422 F221L probably damaging Het
Prkaa2 A G 4: 105,051,998 I83T probably benign Het
R3hdml A G 2: 163,492,606 T39A probably benign Het
Ralgds A G 2: 28,545,172 M447V probably benign Het
Rgs2 T C 1: 144,003,045 D40G probably damaging Het
Robo3 T C 9: 37,418,493 M1176V probably benign Het
Slc26a8 T C 17: 28,638,586 D861G possibly damaging Het
Slc4a8 A T 15: 100,800,588 I705F probably benign Het
Slco3a1 C T 7: 74,297,248 V576I probably damaging Het
Socs7 A G 11: 97,363,147 D169G possibly damaging Het
Tanc1 T C 2: 59,807,589 V878A probably benign Het
Thop1 C T 10: 81,080,167 R395W probably damaging Het
Tpp2 T A 1: 43,978,737 H765Q probably benign Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn1r233 T A 17: 20,993,807 M294L possibly damaging Het
Vmn1r27 T C 6: 58,215,882 T46A probably benign Het
Vmn2r28 A G 7: 5,480,748 S818P probably damaging Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Zfhx3 C T 8: 108,704,218 probably benign Het
Zfp667 A G 7: 6,305,322 M330V probably benign Het
Zhx1 T C 15: 58,052,675 Y725C probably damaging Het
Zhx3 C T 2: 160,782,100 S49N probably benign Het
Other mutations in Olfr855
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr855 APN 9 19585320 missense possibly damaging 0.74
IGL01405:Olfr855 APN 9 19585205 missense probably benign 0.23
IGL01775:Olfr855 APN 9 19584705 missense probably benign 0.04
IGL01920:Olfr855 APN 9 19585022 missense probably benign 0.01
R0501:Olfr855 UTSW 9 19584618 missense probably damaging 1.00
R0600:Olfr855 UTSW 9 19585304 missense possibly damaging 0.47
R0667:Olfr855 UTSW 9 19585447 missense probably benign
R1769:Olfr855 UTSW 9 19585386 missense probably damaging 0.98
R3117:Olfr855 UTSW 9 19584941 missense probably damaging 0.99
R4002:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4003:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4043:Olfr855 UTSW 9 19584995 missense probably benign 0.16
R4243:Olfr855 UTSW 9 19584558 missense probably damaging 1.00
R4672:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4673:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4959:Olfr855 UTSW 9 19585208 missense probably benign
R4973:Olfr855 UTSW 9 19585208 missense probably benign
R5223:Olfr855 UTSW 9 19585026 missense probably benign 0.16
R5681:Olfr855 UTSW 9 19584899 missense probably damaging 1.00
R6005:Olfr855 UTSW 9 19584885 missense probably benign 0.45
R6017:Olfr855 UTSW 9 19585434 missense probably benign 0.00
R6145:Olfr855 UTSW 9 19584888 missense probably benign 0.02
R6615:Olfr855 UTSW 9 19584989 missense probably benign 0.05
R6771:Olfr855 UTSW 9 19585379 missense probably benign 0.16
R6969:Olfr855 UTSW 9 19584590 missense possibly damaging 0.77
R7239:Olfr855 UTSW 9 19585191 missense probably damaging 1.00
R7313:Olfr855 UTSW 9 19584642 missense probably damaging 1.00
R7361:Olfr855 UTSW 9 19584560 missense probably benign 0.00
R8112:Olfr855 UTSW 9 19584724 missense probably benign 0.44
R8470:Olfr855 UTSW 9 19584969 missense probably damaging 0.99
R9155:Olfr855 UTSW 9 19585083 missense probably benign 0.00
R9187:Olfr855 UTSW 9 19584654 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTTGAGCATGGCATGGAAG -3'
(R):5'- AAGAGCTGTGTGAGGCAGTC -3'

Sequencing Primer
(F):5'- CTTGAGCATGGCATGGAAGTAGTTAG -3'
(R):5'- AGGCAGTCTGTGTAAGTGATGCTC -3'
Posted On 2022-05-16