Incidental Mutation 'R9422:Nme8'
ID 712401
Institutional Source Beutler Lab
Gene Symbol Nme8
Ensembl Gene ENSMUSG00000041138
Gene Name NME/NM23 family member 8
Synonyms Sptrx-2, 1700056P15Rik, Txndc3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock # R9422 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 19645078-19697794 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19675748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 234 (V234A)
Ref Sequence ENSEMBL: ENSMUSP00000089358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039340] [ENSMUST00000091763] [ENSMUST00000223466]
AlphaFold Q715T0
Predicted Effect probably benign
Transcript: ENSMUST00000039340
AA Change: V234A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000047052
Gene: ENSMUSG00000041138
AA Change: V234A

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 3.7e-12 PFAM
Pfam:NDK 155 283 2.3e-14 PFAM
NDK 312 452 3.8e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091763
AA Change: V234A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000089358
Gene: ENSMUSG00000041138
AA Change: V234A

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 6.9e-12 PFAM
Pfam:NDK 155 284 1.1e-13 PFAM
NDK 312 449 2.75e-25 SMART
NDK 450 586 1.45e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223466
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal thioredoxin domain and three C-terminal nucleoside diphosphate kinase (NDK) domains, but the NDK domains are thought to be catalytically inactive. The sea urchin ortholog of this gene encodes a component of sperm outer dynein arms, and the protein is implicated in ciliary function. Mutations in this gene are implicated in primary ciliary dyskinesia type 6.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutant displays normal reproductive system phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,849,289 V209I Het
Adamts18 T A 8: 113,775,278 Y317F probably damaging Het
Adgrg6 C T 10: 14,426,996 R863H probably damaging Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Ank2 C A 3: 127,096,856 K55N unknown Het
B3galnt2 A G 13: 13,975,551 T160A probably benign Het
Becn1 C A 11: 101,302,006 probably benign Het
Ccdc151 T A 9: 22,002,332 H48L possibly damaging Het
Ccdc57 T C 11: 120,873,618 N777S possibly damaging Het
Cd302 T C 2: 60,252,353 Y209C probably damaging Het
Cfap69 A G 5: 5,649,851 V63A probably benign Het
Clasp1 T A 1: 118,462,527 I147N possibly damaging Het
Cmtm3 A T 8: 104,340,726 probably benign Het
Cmtm3 G T 8: 104,340,727 probably benign Het
Col15a1 A T 4: 47,293,364 probably null Het
Csn3 A G 5: 87,930,013 N126S probably benign Het
Dcp2 C T 18: 44,405,294 R173C probably damaging Het
Dctn1 T A 6: 83,193,709 H729Q possibly damaging Het
Dopey1 C T 9: 86,543,040 H2138Y probably damaging Het
Fbxo2 T C 4: 148,164,159 L36P unknown Het
Gm13088 T A 4: 143,656,412 K79M probably damaging Het
Gzmg T A 14: 56,158,355 Y49F probably benign Het
Hist1h2bb A G 13: 23,746,957 I55V possibly damaging Het
Hivep1 A G 13: 42,159,737 T1818A probably benign Het
Ipmk T C 10: 71,376,720 S171P possibly damaging Het
Milr1 T A 11: 106,766,979 Y239N probably damaging Het
Muc16 T C 9: 18,641,806 N4397S probably benign Het
Nell1 C A 7: 50,062,639 S69* probably null Het
Notch2 A G 3: 98,147,352 S2444G probably damaging Het
Olfr501-ps1 A T 7: 108,508,948 K297N unknown Het
Olfr855 T A 9: 19,584,672 I45K probably damaging Het
Pex5l T C 3: 33,082,252 probably benign Het
Pgm3 A T 9: 86,561,885 L322H probably damaging Het
Plxna2 T A 1: 194,644,422 F221L probably damaging Het
Prkaa2 A G 4: 105,051,998 I83T probably benign Het
R3hdml A G 2: 163,492,606 T39A probably benign Het
Ralgds A G 2: 28,545,172 M447V probably benign Het
Rgs2 T C 1: 144,003,045 D40G probably damaging Het
Robo3 T C 9: 37,418,493 M1176V probably benign Het
Slc26a8 T C 17: 28,638,586 D861G possibly damaging Het
Slc4a8 A T 15: 100,800,588 I705F probably benign Het
Slco3a1 C T 7: 74,297,248 V576I probably damaging Het
Socs7 A G 11: 97,363,147 D169G possibly damaging Het
Tanc1 T C 2: 59,807,589 V878A probably benign Het
Thop1 C T 10: 81,080,167 R395W probably damaging Het
Tpp2 T A 1: 43,978,737 H765Q probably benign Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn1r233 T A 17: 20,993,807 M294L possibly damaging Het
Vmn1r27 T C 6: 58,215,882 T46A probably benign Het
Vmn2r28 A G 7: 5,480,748 S818P probably damaging Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Zfhx3 C T 8: 108,704,218 probably benign Het
Zfp667 A G 7: 6,305,322 M330V probably benign Het
Zhx1 T C 15: 58,052,675 Y725C probably damaging Het
Zhx3 C T 2: 160,782,100 S49N probably benign Het
Other mutations in Nme8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Nme8 APN 13 19688980 missense probably damaging 1.00
IGL02272:Nme8 APN 13 19658826 missense probably damaging 0.99
IGL02344:Nme8 APN 13 19674404 missense possibly damaging 0.94
IGL02395:Nme8 APN 13 19677908 missense possibly damaging 0.64
IGL02621:Nme8 APN 13 19675648 missense probably damaging 1.00
IGL02645:Nme8 APN 13 19660585 missense probably damaging 1.00
IGL02807:Nme8 APN 13 19675831 unclassified probably benign
IGL03059:Nme8 APN 13 19652244 missense possibly damaging 0.92
IGL03288:Nme8 APN 13 19696606 missense possibly damaging 0.94
IGL03323:Nme8 APN 13 19688950 missense probably benign 0.06
R0139:Nme8 UTSW 13 19677848 missense probably benign 0.19
R0616:Nme8 UTSW 13 19690859 missense probably benign 0.00
R0632:Nme8 UTSW 13 19658036 missense probably damaging 0.96
R1233:Nme8 UTSW 13 19660512 missense possibly damaging 0.71
R1288:Nme8 UTSW 13 19674449 missense possibly damaging 0.87
R1305:Nme8 UTSW 13 19696907 missense possibly damaging 0.90
R1773:Nme8 UTSW 13 19697036 start codon destroyed probably damaging 1.00
R1942:Nme8 UTSW 13 19675808 missense probably damaging 1.00
R1970:Nme8 UTSW 13 19652322 missense probably damaging 1.00
R2012:Nme8 UTSW 13 19696883 missense probably damaging 1.00
R2093:Nme8 UTSW 13 19650872 missense probably damaging 1.00
R2392:Nme8 UTSW 13 19688943 critical splice donor site probably null
R2436:Nme8 UTSW 13 19677859 missense probably damaging 1.00
R2901:Nme8 UTSW 13 19675664 missense probably benign 0.02
R2902:Nme8 UTSW 13 19675664 missense probably benign 0.02
R4665:Nme8 UTSW 13 19674435 missense probably damaging 1.00
R4751:Nme8 UTSW 13 19675638 critical splice donor site probably null
R4785:Nme8 UTSW 13 19657930 missense probably damaging 0.96
R5101:Nme8 UTSW 13 19690847 critical splice donor site probably null
R5217:Nme8 UTSW 13 19696691 missense probably damaging 1.00
R5251:Nme8 UTSW 13 19660625 missense probably benign 0.33
R5356:Nme8 UTSW 13 19652299 missense probably damaging 1.00
R5397:Nme8 UTSW 13 19694379 missense probably damaging 1.00
R5624:Nme8 UTSW 13 19677868 missense possibly damaging 0.94
R6679:Nme8 UTSW 13 19690970 splice site probably null
R7040:Nme8 UTSW 13 19694328 missense probably damaging 1.00
R7111:Nme8 UTSW 13 19675647 missense probably benign 0.06
R7185:Nme8 UTSW 13 19677883 missense probably damaging 1.00
R7670:Nme8 UTSW 13 19658829 missense probably benign 0.01
R7685:Nme8 UTSW 13 19650975 missense probably benign 0.00
R8108:Nme8 UTSW 13 19650960 missense probably benign 0.00
R8331:Nme8 UTSW 13 19658866 missense probably damaging 1.00
R8413:Nme8 UTSW 13 19674519 missense probably benign 0.01
R8808:Nme8 UTSW 13 19675808 missense probably damaging 1.00
R9227:Nme8 UTSW 13 19690214 missense probably benign
R9230:Nme8 UTSW 13 19690214 missense probably benign
Z1088:Nme8 UTSW 13 19688957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACATTAGGTTTTGAGACATCTGAGC -3'
(R):5'- CATGTGCTGATGACTACAAAAGGG -3'

Sequencing Primer
(F):5'- CATCTGAGCATCATATGTCATCAC -3'
(R):5'- CTACAAAAGGGGAGATTTCACTG -3'
Posted On 2022-05-16