Mutagenetix > Incidental Mutation

Incidental Mutation 'R9423:Tecpr1'

712431

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9423 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 144218578 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 54 (V54A)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000085701
AA Change: V54A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: V54A

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (23/23)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007K13Rik	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,466,110		probably benign	Het
2700081O15Rik	T	C	19: 7,420,259	L57P	probably damaging	Het
4932415D10Rik	C	A	10: 82,287,625	V3184L	possibly damaging	Het
Aatk	A	G	11: 120,010,694	S959P	probably damaging	Het
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Abcb10	A	G	8: 123,962,080	S486P		Het
Adamts19	G	T	18: 58,890,355	R274L	possibly damaging	Het
Ahcyl1	C	T	3: 107,671,160	E254K	probably damaging	Het
Ccdc177	T	G	12: 80,757,388	D704A	unknown	Het
Cd200r3	T	C	16: 44,951,532	V53A	probably benign	Het
Cdc42bpg	T	C	19: 6,313,299	L429P	probably damaging	Het
Cdh23	T	C	10: 60,312,608	D2660G	probably damaging	Het
Cfap61	G	T	2: 146,143,235	A1000S	probably damaging	Het
Col28a1	T	C	6: 7,999,601	T1039A	probably benign	Het
Ctsd	A	G	7: 142,385,475	L71P	probably damaging	Het
Dab2ip	C	T	2: 35,709,954	T251M	probably damaging	Het
Dcaf8	T	A	1: 172,179,957	I331N	probably damaging	Het
Dcp2	C	T	18: 44,405,294	R173C	probably damaging	Het
Dgka	C	T	10: 128,721,186	C640Y	probably damaging	Het
Fam189b	T	A	3: 89,184,700	L155Q	probably damaging	Het
Gm10801	AAGT	AAGTAGT	2: 98,663,803		probably null	Het
Gpr141	T	C	13: 19,751,825	N260S	probably benign	Het
Htr2a	T	A	14: 74,706,076	F365L	probably damaging	Het
Kdm5b	T	C	1: 134,587,967	Y110H	possibly damaging	Het
Ktn1	A	G	14: 47,674,861	T362A	probably benign	Het
Ltbp1	G	A	17: 75,290,117	S581N	probably benign	Het
Nr1h4	C	A	10: 89,473,826	R347L	possibly damaging	Het
Olfr1313	A	T	2: 112,072,463	M40K	possibly damaging	Het
Olfr943	G	T	9: 39,184,542	M118I	probably damaging	Het
Parg	T	G	14: 32,217,705	F563V	probably damaging	Het
Pfkfb3	T	C	2: 11,482,465	Y378C	probably damaging	Het
Pitpnm2	A	C	5: 124,133,406	L368R	probably benign	Het
Pkd1l3	A	G	8: 109,623,680	T386A	possibly damaging	Het
Plch2	C	A	4: 154,986,592	C1110F		Het
Poc5	T	C	13: 96,410,606	V459A	probably damaging	Het
Pou4f3	T	C	18: 42,395,894	S301P	probably damaging	Het
Rpf2	T	C	10: 40,225,340	D233G	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Samd4b	A	G	7: 28,414,208	Y111H	probably benign	Het
Serpinb10	C	T	1: 107,538,449	T55M	probably benign	Het
Serpinb1a	C	T	13: 32,842,927	C344Y	probably benign	Het
Shprh	T	C	10: 11,205,263	V1524A	probably damaging	Het
Sirt1	T	C	10: 63,322,246	H463R	probably damaging	Het
Skor2	T	A	18: 76,860,605	L674Q	probably damaging	Het
Slc3a2	T	A	19: 8,712,825	K201M	possibly damaging	Het
Stam	C	A	2: 14,141,753	Q421K	possibly damaging	Het
Steap4	G	A	5: 7,976,720	V228M	probably damaging	Het
Tacr3	A	G	3: 134,932,282	Y400C	probably benign	Het
Tgm3	A	T	2: 130,038,607	E444D	probably benign	Het
Trim30a	A	T	7: 104,429,203	L222Q	probably damaging	Het
Trmt1l	T	C	1: 151,450,066	Y421H	possibly damaging	Het
Usp24	T	C	4: 106,431,670	F2500L	probably damaging	Het
Vmn2r54	T	A	7: 12,615,514	S714C	probably damaging	Het
Washc5	A	G	15: 59,355,886	I409T	probably benign	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
PIT4531001:Tecpr1	UTSW	5	144214067	missense	probably damaging	0.96
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1394:Tecpr1	UTSW	5	144206539	missense	possibly damaging	0.77
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4932:Tecpr1	UTSW	5	144204658	missense	probably damaging	0.97
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5459:Tecpr1	UTSW	5	144207416	missense	probably damaging	1.00
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R5802:Tecpr1	UTSW	5	144206546	missense	probably benign	0.28
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6022:Tecpr1	UTSW	5	144199191	missense	possibly damaging	0.95
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7375:Tecpr1	UTSW	5	144208599	missense	possibly damaging	0.68
R7632:Tecpr1	UTSW	5	144218726	missense	probably benign	0.03
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8135:Tecpr1	UTSW	5	144198602	missense	probably damaging	0.99
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9218:Tecpr1	UTSW	5	144217231	missense	possibly damaging	0.70
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

Posted On

2022-05-16