Mutagenetix > Incidental Mutation

Incidental Mutation 'R9424:Szt2'

712480

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R9424 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118390954 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 691 (L691P)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000075406
AA Change: L691P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: L691P

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	T	A	15: 82,063,642	I580N	probably benign	Het
Adam9	C	A	8: 24,955,937	V814F	probably benign	Het
Aipl1	C	T	11: 72,037,427	G11D	probably damaging	Het
Ak2	A	G	4: 129,002,402	E120G	possibly damaging	Het
Akap9	C	A	5: 3,962,223	Y975*	probably null	Het
Akap9	C	T	5: 3,962,224	Q976*	probably null	Het
Bpnt1	T	C	1: 185,338,138	M9T	possibly damaging	Het
C4bp	C	A	1: 130,657,175	L41F	probably damaging	Het
Car3	A	T	3: 14,864,390	I59F		Het
Card11	T	C	5: 140,908,640	D78G	probably damaging	Het
Ccdc125	A	G	13: 100,684,368	D199G	possibly damaging	Het
Ccdc88c	T	C	12: 100,945,490	D695G	possibly damaging	Het
Cd48	T	A	1: 171,704,864	I237N	possibly damaging	Het
Cep295	T	C	9: 15,333,203	E1319G	probably damaging	Het
Col6a4	C	A	9: 106,068,072	A948S	probably benign	Het
Dcp1b	T	A	6: 119,220,032	Y563*	probably null	Het
Dcp2	C	T	18: 44,405,294	R173C	probably damaging	Het
Ddx59	T	A	1: 136,416,943	Y117*	probably null	Het
Dennd2a	A	T	6: 39,508,360	Y328*	probably null	Het
Dhx30	A	G	9: 110,087,644	L601P	probably damaging	Het
Dip2c	A	G	13: 9,659,395	T1424A	probably damaging	Het
Dlg2	A	G	7: 92,431,117	N733S	probably damaging	Het
Dnah5	C	T	15: 28,272,140	T1030M	probably benign	Het
Fgd5	A	T	6: 91,979,036	R3*	probably null	Het
Gbf1	A	T	19: 46,259,683	T300S	probably benign	Het
Gm5591	A	T	7: 38,520,297	L384Q	probably damaging	Het
Grm5	C	T	7: 88,116,276	A904V	probably benign	Het
Havcr1	T	A	11: 46,778,564	V290E	probably benign	Het
Hspb7	A	G	4: 141,421,930	D49G	possibly damaging	Het
Itpr2	A	T	6: 146,311,007	I1537N	probably damaging	Het
Kalrn	T	C	16: 33,988,818	T2567A	probably benign	Het
Kat8	T	C	7: 127,924,928	L380S	probably benign	Het
Krt2	T	A	15: 101,811,357	Y626F	unknown	Het
Lrrk2	T	A	15: 91,752,185	L1454*	probably null	Het
Mgat4a	C	A	1: 37,490,355	V148F	probably damaging	Het
Mtg1	T	A	7: 140,147,299	Y238*	probably null	Het
Neb	T	A	2: 52,151,398	Q6807L	probably benign	Het
Nlrp9a	C	A	7: 26,560,753	F644L	probably benign	Het
Pcdhb15	A	G	18: 37,474,210	N165S		Het
Pcdhb5	C	A	18: 37,321,067	Q167K	probably damaging	Het
Per1	T	A	11: 69,108,029	M1142K	probably damaging	Het
Piezo1	A	G	8: 122,491,340	V1220A		Het
Pkd1l1	T	C	11: 8,870,091	T1713A		Het
Plec	C	A	15: 76,231,177	A66S	probably benign	Het
Ppfia4	C	A	1: 134,319,306	V559F	possibly damaging	Het
Ppil6	T	C	10: 41,503,028	S224P	probably damaging	Het
Ppp2r2d	T	A	7: 138,874,249	M262K	possibly damaging	Het
Prl7d1	A	T	13: 27,710,202	M127K	probably benign	Het
Rassf9	T	A	10: 102,545,716	C320S	probably benign	Het
Rbm19	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	5: 120,140,280		probably benign	Het
Rin3	T	A	12: 102,369,330	L420*	probably null	Het
Serpina3i	A	G	12: 104,268,471	T354A	probably benign	Het
Serpinb9b	A	G	13: 33,029,561	S34G	probably damaging	Het
Slc19a2	T	C	1: 164,249,326	V25A	probably damaging	Het
Slc1a2	G	A	2: 102,761,049	E375K	probably damaging	Het
Slfn9	T	A	11: 82,987,385	Y306F	possibly damaging	Het
Sparcl1	A	T	5: 104,093,164	D131E	possibly damaging	Het
Srl	A	T	16: 4,483,167	L680Q	probably damaging	Het
Sufu	G	A	19: 46,485,881	W465*	probably null	Het
Tbc1d4	A	T	14: 101,465,660	I783N	probably damaging	Het
Tmem191c	C	T	16: 17,276,662	R62*	probably null	Het
Tmem217	C	A	17: 29,526,716	M13I	possibly damaging	Het
Triobp	T	C	15: 78,960,066	S161P	probably damaging	Het
Trp53bp2	T	C	1: 182,446,299	V503A	possibly damaging	Het
Tspoap1	G	A	11: 87,761,256		probably benign	Het
Ttn	T	C	2: 76,752,003	T22849A	probably damaging	Het
Ugt2b37	A	T	5: 87,254,358	M138K	probably damaging	Het
Uimc1	A	T	13: 55,075,833	F209I	possibly damaging	Het
Vipr1	G	A	9: 121,642,927		probably null	Het
Wdr91	A	T	6: 34,884,367	N633K	possibly damaging	Het
Zfp618	T	C	4: 63,133,045	S688P	probably benign	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACCCACCTGATGAGGAGC -3'
(R):5'- CATAAGGTAAGCCCTGACGG -3'

Sequencing Primer
(F):5'- CACCTGATGAGGAGCTTGTC -3'
(R):5'- GGGTACGATGAACTGTTTCCTC -3'

Posted On

2022-05-16