Incidental Mutation 'R9424:Prl7d1'
ID 712519
Institutional Source Beutler Lab
Gene Symbol Prl7d1
Ensembl Gene ENSMUSG00000021348
Gene Name prolactin family 7, subfamily d, member 1
Synonyms Plfr, PRP, PLF-RP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9424 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 27706337-27716736 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27710202 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 127 (M127K)
Ref Sequence ENSEMBL: ENSMUSP00000021776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021776] [ENSMUST00000224026]
AlphaFold P04769
Predicted Effect probably benign
Transcript: ENSMUST00000021776
AA Change: M127K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021776
Gene: ENSMUSG00000021348
AA Change: M127K

DomainStartEndE-ValueType
Pfam:Hormone_1 17 240 1.1e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224026
AA Change: M128K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,063,642 I580N probably benign Het
Adam9 C A 8: 24,955,937 V814F probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Ak2 A G 4: 129,002,402 E120G possibly damaging Het
Akap9 C A 5: 3,962,223 Y975* probably null Het
Akap9 C T 5: 3,962,224 Q976* probably null Het
Bpnt1 T C 1: 185,338,138 M9T possibly damaging Het
C4bp C A 1: 130,657,175 L41F probably damaging Het
Car3 A T 3: 14,864,390 I59F Het
Card11 T C 5: 140,908,640 D78G probably damaging Het
Ccdc125 A G 13: 100,684,368 D199G possibly damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Cd48 T A 1: 171,704,864 I237N possibly damaging Het
Cep295 T C 9: 15,333,203 E1319G probably damaging Het
Col6a4 C A 9: 106,068,072 A948S probably benign Het
Dcp1b T A 6: 119,220,032 Y563* probably null Het
Dcp2 C T 18: 44,405,294 R173C probably damaging Het
Ddx59 T A 1: 136,416,943 Y117* probably null Het
Dennd2a A T 6: 39,508,360 Y328* probably null Het
Dhx30 A G 9: 110,087,644 L601P probably damaging Het
Dip2c A G 13: 9,659,395 T1424A probably damaging Het
Dlg2 A G 7: 92,431,117 N733S probably damaging Het
Dnah5 C T 15: 28,272,140 T1030M probably benign Het
Fgd5 A T 6: 91,979,036 R3* probably null Het
Gbf1 A T 19: 46,259,683 T300S probably benign Het
Gm5591 A T 7: 38,520,297 L384Q probably damaging Het
Grm5 C T 7: 88,116,276 A904V probably benign Het
Havcr1 T A 11: 46,778,564 V290E probably benign Het
Hspb7 A G 4: 141,421,930 D49G possibly damaging Het
Itpr2 A T 6: 146,311,007 I1537N probably damaging Het
Kalrn T C 16: 33,988,818 T2567A probably benign Het
Kat8 T C 7: 127,924,928 L380S probably benign Het
Krt2 T A 15: 101,811,357 Y626F unknown Het
Lrrk2 T A 15: 91,752,185 L1454* probably null Het
Mgat4a C A 1: 37,490,355 V148F probably damaging Het
Mtg1 T A 7: 140,147,299 Y238* probably null Het
Neb T A 2: 52,151,398 Q6807L probably benign Het
Nlrp9a C A 7: 26,560,753 F644L probably benign Het
Pcdhb15 A G 18: 37,474,210 N165S Het
Pcdhb5 C A 18: 37,321,067 Q167K probably damaging Het
Per1 T A 11: 69,108,029 M1142K probably damaging Het
Piezo1 A G 8: 122,491,340 V1220A Het
Pkd1l1 T C 11: 8,870,091 T1713A Het
Plec C A 15: 76,231,177 A66S probably benign Het
Ppfia4 C A 1: 134,319,306 V559F possibly damaging Het
Ppil6 T C 10: 41,503,028 S224P probably damaging Het
Ppp2r2d T A 7: 138,874,249 M262K possibly damaging Het
Rassf9 T A 10: 102,545,716 C320S probably benign Het
Rbm19 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 5: 120,140,280 probably benign Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Serpina3i A G 12: 104,268,471 T354A probably benign Het
Serpinb9b A G 13: 33,029,561 S34G probably damaging Het
Slc19a2 T C 1: 164,249,326 V25A probably damaging Het
Slc1a2 G A 2: 102,761,049 E375K probably damaging Het
Slfn9 T A 11: 82,987,385 Y306F possibly damaging Het
Sparcl1 A T 5: 104,093,164 D131E possibly damaging Het
Srl A T 16: 4,483,167 L680Q probably damaging Het
Sufu G A 19: 46,485,881 W465* probably null Het
Szt2 A G 4: 118,390,954 L691P probably damaging Het
Tbc1d4 A T 14: 101,465,660 I783N probably damaging Het
Tmem191c C T 16: 17,276,662 R62* probably null Het
Tmem217 C A 17: 29,526,716 M13I possibly damaging Het
Triobp T C 15: 78,960,066 S161P probably damaging Het
Trp53bp2 T C 1: 182,446,299 V503A possibly damaging Het
Tspoap1 G A 11: 87,761,256 probably benign Het
Ttn T C 2: 76,752,003 T22849A probably damaging Het
Ugt2b37 A T 5: 87,254,358 M138K probably damaging Het
Uimc1 A T 13: 55,075,833 F209I possibly damaging Het
Vipr1 G A 9: 121,642,927 probably null Het
Wdr91 A T 6: 34,884,367 N633K possibly damaging Het
Zfp618 T C 4: 63,133,045 S688P probably benign Het
Other mutations in Prl7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Prl7d1 APN 13 27710166 missense possibly damaging 0.91
IGL01735:Prl7d1 APN 13 27714389 missense possibly damaging 0.83
IGL02139:Prl7d1 APN 13 27712083 missense probably damaging 1.00
PIT4305001:Prl7d1 UTSW 13 27714337 missense possibly damaging 0.90
PIT4531001:Prl7d1 UTSW 13 27710178 missense probably damaging 1.00
R0555:Prl7d1 UTSW 13 27712055 missense probably benign 0.13
R0625:Prl7d1 UTSW 13 27710140 missense probably benign 0.10
R0631:Prl7d1 UTSW 13 27710182 missense probably benign 0.32
R0837:Prl7d1 UTSW 13 27714338 missense probably benign 0.06
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1459:Prl7d1 UTSW 13 27709257 missense possibly damaging 0.81
R1643:Prl7d1 UTSW 13 27712131 missense possibly damaging 0.53
R1691:Prl7d1 UTSW 13 27709382 missense probably damaging 0.97
R2016:Prl7d1 UTSW 13 27710173 missense probably damaging 1.00
R3873:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R3874:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R5251:Prl7d1 UTSW 13 27709244 missense probably benign 0.33
R5275:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5295:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5398:Prl7d1 UTSW 13 27710074 missense probably damaging 1.00
R6798:Prl7d1 UTSW 13 27709397 critical splice acceptor site probably null
R6818:Prl7d1 UTSW 13 27714471 missense probably benign 0.07
R6825:Prl7d1 UTSW 13 27710142 missense probably benign 0.01
R7478:Prl7d1 UTSW 13 27710185 nonsense probably null
R7795:Prl7d1 UTSW 13 27709280 missense probably damaging 1.00
R7995:Prl7d1 UTSW 13 27710071 missense probably benign
R8193:Prl7d1 UTSW 13 27709247 missense
R9313:Prl7d1 UTSW 13 27709199 missense probably benign
R9430:Prl7d1 UTSW 13 27714377 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GCCTAACTTTTGATCTTGCAAAGTG -3'
(R):5'- ACAGGTGACCAGTCTAACTTATAC -3'

Sequencing Primer
(F):5'- TGATCTTGCAAAGTGAAGTGTTTC -3'
(R):5'- GGTGACCAGTCTAACTTATACACTGC -3'
Posted On 2022-05-16