Mutagenetix > Incidental Mutation

Incidental Mutation 'R9424:Plec'

712525

Institutional Source

Beutler Lab

Gene Symbol

Plec

Ensembl Gene

ENSMUSG00000022565

Gene Name

plectin

Synonyms

Plec1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.782) question?

Stock #

R9424 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76055174-76115578 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 76115377 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 66 (A66S)

Ref Sequence

ENSEMBL: ENSMUSP00000130915 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074834] [ENSMUST00000075689] [ENSMUST00000089610] [ENSMUST00000165738] [ENSMUST00000166428] [ENSMUST00000167754]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000074834

SMART Domains

Protein: ENSMUSP00000074383
Gene: ENSMUSG00000022565

Domain	Start	End	E-Value	Type
CH	35	134	4.57e-28	SMART
CH	151	249	3.52e-20	SMART
internal_repeat_2	284	366	1.19e-5	PROSPERO
internal_repeat_2	360	442	1.19e-5	PROSPERO
SPEC	507	604	3.08e-5	SMART
SPEC	607	707	1.29e-7	SMART
SPEC	713	875	3.01e0	SMART
low complexity region	954	968	N/A	INTRINSIC
SPEC	971	1077	3.48e0	SMART
SPEC	1080	1191	7.63e-1	SMART
SPEC	1198	1358	2.59e-1	SMART
low complexity region	1362	1402	N/A	INTRINSIC
low complexity region	1429	1446	N/A	INTRINSIC
low complexity region	1459	1490	N/A	INTRINSIC
low complexity region	1501	1550	N/A	INTRINSIC
low complexity region	1592	1621	N/A	INTRINSIC
low complexity region	1646	1671	N/A	INTRINSIC
low complexity region	1709	1730	N/A	INTRINSIC
low complexity region	1757	1821	N/A	INTRINSIC
low complexity region	1837	1862	N/A	INTRINSIC
low complexity region	1923	1937	N/A	INTRINSIC
low complexity region	1951	1977	N/A	INTRINSIC
low complexity region	2007	2041	N/A	INTRINSIC
low complexity region	2047	2061	N/A	INTRINSIC
low complexity region	2068	2096	N/A	INTRINSIC
low complexity region	2105	2154	N/A	INTRINSIC
low complexity region	2171	2186	N/A	INTRINSIC
low complexity region	2274	2290	N/A	INTRINSIC
low complexity region	2313	2331	N/A	INTRINSIC
low complexity region	2382	2395	N/A	INTRINSIC
low complexity region	2433	2463	N/A	INTRINSIC
low complexity region	2516	2537	N/A	INTRINSIC
low complexity region	2541	2556	N/A	INTRINSIC
low complexity region	2558	2599	N/A	INTRINSIC
PLEC	2638	2675	2.99e1	SMART
PLEC	2676	2713	4.49e-7	SMART
PLEC	2714	2751	4.49e-7	SMART
PLEC	2752	2789	3.54e-5	SMART
PLEC	2790	2827	3.27e-9	SMART
PLEC	2831	2865	6.31e-2	SMART
low complexity region	2936	2954	N/A	INTRINSIC
PLEC	2966	3003	3.84e0	SMART
PLEC	3004	3041	1.59e-7	SMART
PLEC	3042	3079	3.54e-5	SMART
PLEC	3080	3117	8.64e-9	SMART
PLEC	3118	3155	1.53e-9	SMART
PLEC	3158	3193	2.18e2	SMART
low complexity region	3265	3284	N/A	INTRINSIC
PLEC	3335	3372	3.22e-8	SMART
PLEC	3373	3410	7.82e-7	SMART
PLEC	3411	3448	1.9e-5	SMART
PLEC	3449	3486	7.01e-9	SMART
PLEC	3490	3524	3.38e-2	SMART
low complexity region	3536	3557	N/A	INTRINSIC
low complexity region	3563	3573	N/A	INTRINSIC
low complexity region	3606	3619	N/A	INTRINSIC
PLEC	3670	3707	1.22e-8	SMART
PLEC	3708	3745	1.26e-10	SMART
PLEC	3746	3783	2.24e-7	SMART
PLEC	3784	3821	1.82e-7	SMART
PLEC	3825	3858	5.49e1	SMART
PLEC	3862	3895	3.2e2	SMART
PLEC	3913	3950	8.77e-10	SMART
PLEC	3951	3988	4.13e-6	SMART
PLEC	3989	4026	3.03e-4	SMART
PLEC	4027	4064	4.77e-11	SMART
PLEC	4068	4102	1.28e-2	SMART
PLEC	4115	4155	1.05e-7	SMART
low complexity region	4157	4167	N/A	INTRINSIC
PLEC	4169	4206	1.73e1	SMART
low complexity region	4232	4247	N/A	INTRINSIC
PLEC	4258	4295	3.65e-7	SMART
PLEC	4296	4333	9.99e-14	SMART
PLEC	4334	4371	4.71e-1	SMART
PLEC	4372	4409	2.44e-8	SMART
PLEC	4410	4447	2.87e-5	SMART
low complexity region	4457	4492	N/A	INTRINSIC
low complexity region	4495	4521	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075689

SMART Domains

Protein: ENSMUSP00000075110
Gene: ENSMUSG00000063268

Domain	Start	End	E-Value	Type
Blast:RRM_2	9	72	1e-13	BLAST
PDB:2DHX\|A	9	98	1e-30	PDB
low complexity region	183	193	N/A	INTRINSIC
low complexity region	275	285	N/A	INTRINSIC
low complexity region	566	575	N/A	INTRINSIC
low complexity region	579	593	N/A	INTRINSIC
UIM	605	624	9.27e1	SMART
UIM	628	647	1.88e1	SMART
low complexity region	728	738	N/A	INTRINSIC
Pfam:PARP	766	954	8.1e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000089610
AA Change: A66S

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000087037
Gene: ENSMUSG00000022565
AA Change: A66S

Domain	Start	End	E-Value	Type
low complexity region	16	28	N/A	INTRINSIC
low complexity region	40	54	N/A	INTRINSIC
CH	73	189	1.46e-26	SMART
CH	206	304	3.52e-20	SMART
internal_repeat_2	339	421	1.38e-5	PROSPERO
internal_repeat_2	415	497	1.38e-5	PROSPERO
SPEC	562	659	3.08e-5	SMART
SPEC	662	762	1.29e-7	SMART
SPEC	768	930	3.01e0	SMART
low complexity region	1009	1023	N/A	INTRINSIC
SPEC	1026	1132	3.48e0	SMART
SPEC	1135	1246	7.63e-1	SMART
SPEC	1253	1413	2.59e-1	SMART
low complexity region	1417	1457	N/A	INTRINSIC
low complexity region	1484	1501	N/A	INTRINSIC
low complexity region	1514	1545	N/A	INTRINSIC
low complexity region	1556	1605	N/A	INTRINSIC
low complexity region	1647	1676	N/A	INTRINSIC
low complexity region	1701	1726	N/A	INTRINSIC
low complexity region	1764	1785	N/A	INTRINSIC
low complexity region	1812	1876	N/A	INTRINSIC
low complexity region	1892	1917	N/A	INTRINSIC
low complexity region	1978	1992	N/A	INTRINSIC
low complexity region	2006	2032	N/A	INTRINSIC
low complexity region	2062	2096	N/A	INTRINSIC
low complexity region	2102	2116	N/A	INTRINSIC
low complexity region	2123	2151	N/A	INTRINSIC
low complexity region	2160	2209	N/A	INTRINSIC
low complexity region	2226	2241	N/A	INTRINSIC
low complexity region	2329	2345	N/A	INTRINSIC
low complexity region	2368	2386	N/A	INTRINSIC
low complexity region	2437	2450	N/A	INTRINSIC
low complexity region	2488	2518	N/A	INTRINSIC
low complexity region	2571	2592	N/A	INTRINSIC
low complexity region	2596	2611	N/A	INTRINSIC
low complexity region	2613	2654	N/A	INTRINSIC
PLEC	2693	2730	2.99e1	SMART
PLEC	2731	2768	4.49e-7	SMART
PLEC	2769	2806	4.49e-7	SMART
PLEC	2807	2844	3.54e-5	SMART
PLEC	2845	2882	3.27e-9	SMART
PLEC	2886	2920	6.31e-2	SMART
low complexity region	2991	3009	N/A	INTRINSIC
PLEC	3021	3058	3.84e0	SMART
PLEC	3059	3096	1.59e-7	SMART
PLEC	3097	3134	3.54e-5	SMART
PLEC	3135	3172	8.64e-9	SMART
PLEC	3173	3210	1.53e-9	SMART
PLEC	3213	3248	2.18e2	SMART
low complexity region	3320	3339	N/A	INTRINSIC
PLEC	3390	3427	3.22e-8	SMART
PLEC	3428	3465	7.82e-7	SMART
PLEC	3466	3503	1.9e-5	SMART
PLEC	3504	3541	7.01e-9	SMART
PLEC	3545	3579	3.38e-2	SMART
low complexity region	3591	3612	N/A	INTRINSIC
low complexity region	3618	3628	N/A	INTRINSIC
low complexity region	3661	3674	N/A	INTRINSIC
PLEC	3725	3762	1.22e-8	SMART
PLEC	3763	3800	1.26e-10	SMART
PLEC	3801	3838	2.24e-7	SMART
PLEC	3839	3876	1.82e-7	SMART
PLEC	3880	3913	5.49e1	SMART
PLEC	3917	3950	3.2e2	SMART
PLEC	3968	4005	8.77e-10	SMART
PLEC	4006	4043	4.13e-6	SMART
PLEC	4044	4081	3.03e-4	SMART
PLEC	4082	4119	4.77e-11	SMART
PLEC	4123	4157	1.28e-2	SMART
PLEC	4170	4210	1.05e-7	SMART
low complexity region	4212	4222	N/A	INTRINSIC
PLEC	4224	4261	1.73e1	SMART
low complexity region	4287	4302	N/A	INTRINSIC
PLEC	4313	4350	3.65e-7	SMART
PLEC	4351	4388	9.99e-14	SMART
PLEC	4389	4426	4.71e-1	SMART
PLEC	4427	4464	2.44e-8	SMART
PLEC	4465	4502	2.87e-5	SMART
low complexity region	4512	4547	N/A	INTRINSIC
low complexity region	4550	4576	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165738

SMART Domains

Protein: ENSMUSP00000129765
Gene: ENSMUSG00000063268

Domain	Start	End	E-Value	Type
Blast:RRM_2	9	72	1e-13	BLAST
PDB:2DHX\|A	9	98	1e-30	PDB
low complexity region	183	193	N/A	INTRINSIC
low complexity region	275	285	N/A	INTRINSIC
low complexity region	566	575	N/A	INTRINSIC
low complexity region	579	593	N/A	INTRINSIC
UIM	605	624	9.27e1	SMART
UIM	628	647	1.88e1	SMART
low complexity region	728	738	N/A	INTRINSIC
Pfam:PARP	766	954	8.1e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000166428
AA Change: A66S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000130915
Gene: ENSMUSG00000022565
AA Change: A66S

Domain	Start	End	E-Value	Type
low complexity region	16	28	N/A	INTRINSIC
low complexity region	40	54	N/A	INTRINSIC
CH	73	189	1.46e-26	SMART
CH	206	304	3.52e-20	SMART
PDB:2ODU\|A	318	549	1e-154	PDB
Blast:SPEC	328	431	3e-63	BLAST
SPEC	562	659	3.08e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167754
AA Change: A66S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000127867
Gene: ENSMUSG00000022565
AA Change: A66S

Domain	Start	End	E-Value	Type
low complexity region	16	28	N/A	INTRINSIC
low complexity region	40	54	N/A	INTRINSIC
CH	73	189	1.46e-26	SMART
CH	206	304	3.52e-20	SMART
PDB:2ODU\|A	318	549	1e-154	PDB
Blast:SPEC	328	431	3e-63	BLAST
SPEC	562	659	3.08e-5	SMART
low complexity region	677	682	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170226

SMART Domains

Protein: ENSMUSP00000131370
Gene: ENSMUSG00000063268

Domain	Start	End	E-Value	Type
Pfam:PARP	1	104	6.1e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Plectin is a prominent member of an important family of structurally and in part functionally related proteins, termed plakins or cytolinkers, that are capable of interlinking different elements of the cytoskeleton. Plakins, with their multi-domain structure and enormous size, not only play crucial roles in maintaining cell and tissue integrity and orchestrating dynamic changes in cytoarchitecture and cell shape, but also serve as scaffolding platforms for the assembly, positioning, and regulation of signaling complexes (reviewed in PMID: 9701547, 11854008, 17499243). Plectin is expressed as several protein isoforms in a wide range of cell types and tissues from a single gene located on chromosome 8 in humans (PMID: 8633055, 8698233). Until 2010, this locus was named plectin 1 (symbol PLEC1 in human; Plec1 in mouse and rat) and the gene product had been referred to as "hemidesmosomal protein 1" or "plectin 1, intermediate filament binding 500kDa". These names were superseded by plectin. The plectin gene locus in mouse on chromosome 15 has been analyzed in detail (PMID: 10556294, 14559777), revealing a genomic exon-intron organization with well over 40 exons spanning over 62 kb and an unusual 5' transcript complexity of plectin isoforms. Eleven exons (1-1j) have been identified that alternatively splice directly into a common exon 2 which is the first exon to encode plectin's highly conserved actin binding domain (ABD). Three additional exons (-1, 0a, and 0) splice into an alternative first coding exon (1c), and two additional exons (2alpha and 3alpha) are optionally spliced within the exons encoding the acting binding domain (exons 2-8). Analysis of the human locus has identified eight of the eleven alternative 5' exons found in mouse and rat (PMID: 14672974); exons 1i, 1j and 1h have not been confirmed in human. Furthermore, isoforms lacking the central rod domain encoded by exon 31 have been detected in mouse (PMID:10556294), rat (PMID: 9177781), and human (PMID: 11441066, 10780662, 20052759). It has been shown that the short alternative amino-terminal sequences encoded by the different first exons direct the targeting of the various isoforms to distinct subcellular locations (PMID: 14559777). As the expression of specific plectin isoforms was found to be dependent on cell type (tissue) and stage of development (PMID: 10556294, 12542521, 17389230) it appears that each cell type (tissue) contains a unique set (proportion and composition) of plectin isoforms, as if custom-made for specific requirements of the particular cells. Concordantly, individual isoforms were found to carry out distinct and specific functions (PMID: 14559777, 12542521, 18541706). In 1996, a number of groups reported that patients suffering from epidermolysis bullosa simplex with muscular dystrophy (EBS-MD) lacked plectin expression in skin and muscle tissues due to defects in the plectin gene (PMID: 8698233, 8941634, 8636409, 8894687, 8696340). Two other subtypes of plectin-related EBS have been described: EBS-pyloric atresia (PA) and EBS-Ogna. For reviews of plectin-related diseases see PMID: 15810881, 19945614. Mutations in the plectin gene related to human diseases should be named based on the position in NM_000445 (human variant 1, isoform 1c), unless the mutation is located within one of the other alternative first exons, in which case the position in the respective Reference Sequence should be used. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted mutations of this gene result in neonatal death, skin blistering, impaired myofibril integrity, reduced hemidesmosome number, and disintegration of intercalated disks in the heart. Mice lacking isoform 1 are viable with no skin blistering but leukocyte recruitment to wounds is impaired. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	T	A	15: 81,947,843 (GRCm39)	I580N	probably benign	Het
Adam9	C	A	8: 25,445,953 (GRCm39)	V814F	probably benign	Het
Aipl1	C	T	11: 71,928,253 (GRCm39)	G11D	probably damaging	Het
Ak2	A	G	4: 128,896,195 (GRCm39)	E120G	possibly damaging	Het
Akap9	C	A	5: 4,012,223 (GRCm39)	Y975*	probably null	Het
Akap9	C	T	5: 4,012,224 (GRCm39)	Q976*	probably null	Het
Bpnt1	T	C	1: 185,070,335 (GRCm39)	M9T	possibly damaging	Het
C4bp	C	A	1: 130,584,912 (GRCm39)	L41F	probably damaging	Het
Car3	A	T	3: 14,929,450 (GRCm39)	I59F		Het
Card11	T	C	5: 140,894,395 (GRCm39)	D78G	probably damaging	Het
Ccdc125	A	G	13: 100,820,876 (GRCm39)	D199G	possibly damaging	Het
Ccdc88c	T	C	12: 100,911,749 (GRCm39)	D695G	possibly damaging	Het
Cd48	T	A	1: 171,532,432 (GRCm39)	I237N	possibly damaging	Het
Cep295	T	C	9: 15,244,499 (GRCm39)	E1319G	probably damaging	Het
Col6a4	C	A	9: 105,945,271 (GRCm39)	A948S	probably benign	Het
Dcp1b	T	A	6: 119,196,993 (GRCm39)	Y563*	probably null	Het
Dcp2	C	T	18: 44,538,361 (GRCm39)	R173C	probably damaging	Het
Ddx59	T	A	1: 136,344,681 (GRCm39)	Y117*	probably null	Het
Dennd2a	A	T	6: 39,485,294 (GRCm39)	Y328*	probably null	Het
Dhx30	A	G	9: 109,916,712 (GRCm39)	L601P	probably damaging	Het
Dip2c	A	G	13: 9,709,431 (GRCm39)	T1424A	probably damaging	Het
Dlg2	A	G	7: 92,080,325 (GRCm39)	N733S	probably damaging	Het
Dnah5	C	T	15: 28,272,286 (GRCm39)	T1030M	probably benign	Het
Fgd5	A	T	6: 91,956,017 (GRCm39)	R3*	probably null	Het
Gbf1	A	T	19: 46,248,122 (GRCm39)	T300S	probably benign	Het
Gm5591	A	T	7: 38,219,721 (GRCm39)	L384Q	probably damaging	Het
Grm5	C	T	7: 87,765,484 (GRCm39)	A904V	probably benign	Het
Havcr1	T	A	11: 46,669,391 (GRCm39)	V290E	probably benign	Het
Hspb7	A	G	4: 141,149,241 (GRCm39)	D49G	possibly damaging	Het
Itpr2	A	T	6: 146,212,505 (GRCm39)	I1537N	probably damaging	Het
Kalrn	T	C	16: 33,809,188 (GRCm39)	T2567A	probably benign	Het
Kat8	T	C	7: 127,524,100 (GRCm39)	L380S	probably benign	Het
Krt1c	T	A	15: 101,719,792 (GRCm39)	Y626F	unknown	Het
Lrrk2	T	A	15: 91,636,388 (GRCm39)	L1454*	probably null	Het
Mgat4a	C	A	1: 37,529,436 (GRCm39)	V148F	probably damaging	Het
Mtg1	T	A	7: 139,727,212 (GRCm39)	Y238*	probably null	Het
Neb	T	A	2: 52,041,410 (GRCm39)	Q6807L	probably benign	Het
Nlrp9a	C	A	7: 26,260,178 (GRCm39)	F644L	probably benign	Het
Pcdhb15	A	G	18: 37,607,263 (GRCm39)	N165S		Het
Pcdhb5	C	A	18: 37,454,120 (GRCm39)	Q167K	probably damaging	Het
Per1	T	A	11: 68,998,855 (GRCm39)	M1142K	probably damaging	Het
Piezo1	A	G	8: 123,218,079 (GRCm39)	V1220A		Het
Pkd1l1	T	C	11: 8,820,091 (GRCm39)	T1713A		Het
Ppfia4	C	A	1: 134,247,044 (GRCm39)	V559F	possibly damaging	Het
Ppil6	T	C	10: 41,379,024 (GRCm39)	S224P	probably damaging	Het
Ppp2r2d	T	A	7: 138,475,978 (GRCm39)	M262K	possibly damaging	Het
Prl7d1	A	T	13: 27,894,185 (GRCm39)	M127K	probably benign	Het
Rassf9	T	A	10: 102,381,577 (GRCm39)	C320S	probably benign	Het
Rbm19	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	5: 120,278,345 (GRCm39)		probably benign	Het
Rin3	T	A	12: 102,335,589 (GRCm39)	L420*	probably null	Het
Serpina3i	A	G	12: 104,234,730 (GRCm39)	T354A	probably benign	Het
Serpinb9b	A	G	13: 33,213,544 (GRCm39)	S34G	probably damaging	Het
Slc19a2	T	C	1: 164,076,895 (GRCm39)	V25A	probably damaging	Het
Slc1a2	G	A	2: 102,591,394 (GRCm39)	E375K	probably damaging	Het
Slfn9	T	A	11: 82,878,211 (GRCm39)	Y306F	possibly damaging	Het
Sparcl1	A	T	5: 104,241,030 (GRCm39)	D131E	possibly damaging	Het
Srl	A	T	16: 4,301,031 (GRCm39)	L680Q	probably damaging	Het
Sufu	G	A	19: 46,474,320 (GRCm39)	W465*	probably null	Het
Szt2	A	G	4: 118,248,151 (GRCm39)	L691P	probably damaging	Het
Tbc1d4	A	T	14: 101,703,096 (GRCm39)	I783N	probably damaging	Het
Tmem191	C	T	16: 17,094,526 (GRCm39)	R62*	probably null	Het
Tmem217	C	A	17: 29,745,690 (GRCm39)	M13I	possibly damaging	Het
Triobp	T	C	15: 78,844,266 (GRCm39)	S161P	probably damaging	Het
Trp53bp2	T	C	1: 182,273,864 (GRCm39)	V503A	possibly damaging	Het
Tspoap1	G	A	11: 87,652,082 (GRCm39)		probably benign	Het
Ttn	T	C	2: 76,582,347 (GRCm39)	T22849A	probably damaging	Het
Ugt2b37	A	T	5: 87,402,217 (GRCm39)	M138K	probably damaging	Het
Uimc1	A	T	13: 55,223,646 (GRCm39)	F209I	possibly damaging	Het
Vipr1	G	A	9: 121,471,993 (GRCm39)		probably null	Het
Wdr91	A	T	6: 34,861,302 (GRCm39)	N633K	possibly damaging	Het
Zfp618	T	C	4: 63,051,282 (GRCm39)	S688P	probably benign	Het

Other mutations in Plec

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00791:Plec	APN	15	76,057,137 (GRCm39)	missense	probably damaging	1.00
IGL01375:Plec	APN	15	76,060,640 (GRCm39)	missense	probably damaging	1.00
IGL01432:Plec	APN	15	76,074,728 (GRCm39)	missense	probably damaging	1.00
IGL01444:Plec	APN	15	76,063,497 (GRCm39)	missense	possibly damaging	0.46
IGL01548:Plec	APN	15	76,073,458 (GRCm39)	missense	probably benign	0.00
IGL01750:Plec	APN	15	76,057,589 (GRCm39)	missense	probably damaging	1.00
IGL01828:Plec	APN	15	76,067,955 (GRCm39)	missense	probably damaging	1.00
IGL01940:Plec	APN	15	76,064,529 (GRCm39)	missense	probably damaging	1.00
IGL02049:Plec	APN	15	76,063,149 (GRCm39)	missense	probably damaging	1.00
IGL02052:Plec	APN	15	76,064,541 (GRCm39)	missense	probably damaging	1.00
IGL02114:Plec	APN	15	76,057,748 (GRCm39)	missense	probably damaging	1.00
IGL02141:Plec	APN	15	76,059,815 (GRCm39)	missense	probably damaging	1.00
IGL02162:Plec	APN	15	76,064,360 (GRCm39)	missense	probably benign	0.01
IGL02227:Plec	APN	15	76,056,474 (GRCm39)	missense	probably damaging	1.00
IGL02449:Plec	APN	15	76,070,963 (GRCm39)	missense	possibly damaging	0.93
IGL02450:Plec	APN	15	76,075,515 (GRCm39)	missense	probably damaging	1.00
IGL02454:Plec	APN	15	76,075,231 (GRCm39)	missense	probably damaging	0.96
IGL02488:Plec	APN	15	76,063,359 (GRCm39)	missense	possibly damaging	0.92
IGL02490:Plec	APN	15	76,073,463 (GRCm39)	missense	probably damaging	1.00
IGL02494:Plec	APN	15	76,060,979 (GRCm39)	missense	probably damaging	1.00
IGL02869:Plec	APN	15	76,065,516 (GRCm39)	missense	probably damaging	1.00
IGL02900:Plec	APN	15	76,070,414 (GRCm39)	missense	probably damaging	1.00
IGL03059:Plec	APN	15	76,059,968 (GRCm39)	missense	probably damaging	1.00
IGL03091:Plec	APN	15	76,073,503 (GRCm39)	missense	possibly damaging	0.58
IGL03094:Plec	APN	15	76,075,519 (GRCm39)	missense	probably damaging	1.00
R0013:Plec	UTSW	15	76,062,446 (GRCm39)	missense	probably damaging	0.96
R0076:Plec	UTSW	15	76,075,614 (GRCm39)	splice site	probably benign
R0092:Plec	UTSW	15	76,067,943 (GRCm39)	missense	probably benign	0.05
R0106:Plec	UTSW	15	76,060,518 (GRCm39)	missense	probably damaging	1.00
R0111:Plec	UTSW	15	76,062,846 (GRCm39)	missense	probably damaging	1.00
R0212:Plec	UTSW	15	76,075,505 (GRCm39)	nonsense	probably null
R0329:Plec	UTSW	15	76,075,618 (GRCm39)	critical splice donor site	probably null
R0330:Plec	UTSW	15	76,075,618 (GRCm39)	critical splice donor site	probably null
R0334:Plec	UTSW	15	76,062,206 (GRCm39)	missense	probably damaging	0.99
R0345:Plec	UTSW	15	76,061,367 (GRCm39)	missense	probably damaging	1.00
R0457:Plec	UTSW	15	76,061,801 (GRCm39)	missense	probably damaging	1.00
R0507:Plec	UTSW	15	76,056,983 (GRCm39)	missense	probably damaging	1.00
R0531:Plec	UTSW	15	76,061,498 (GRCm39)	missense	probably benign	0.11
R0578:Plec	UTSW	15	76,061,084 (GRCm39)	missense	probably damaging	1.00
R0594:Plec	UTSW	15	76,056,453 (GRCm39)	missense	probably damaging	1.00
R0632:Plec	UTSW	15	76,057,611 (GRCm39)	missense	probably damaging	1.00
R0670:Plec	UTSW	15	76,090,160 (GRCm39)	missense	probably damaging	0.99
R0742:Plec	UTSW	15	76,056,983 (GRCm39)	missense	probably damaging	1.00
R0833:Plec	UTSW	15	76,066,107 (GRCm39)	unclassified	probably benign
R0836:Plec	UTSW	15	76,066,107 (GRCm39)	unclassified	probably benign
R0863:Plec	UTSW	15	76,058,280 (GRCm39)	nonsense	probably null
R0948:Plec	UTSW	15	76,089,887 (GRCm39)	missense	probably benign
R1163:Plec	UTSW	15	76,068,038 (GRCm39)	missense	possibly damaging	0.90
R1437:Plec	UTSW	15	76,073,481 (GRCm39)	missense	probably damaging	0.99
R1466:Plec	UTSW	15	76,070,108 (GRCm39)	missense	possibly damaging	0.88
R1466:Plec	UTSW	15	76,070,108 (GRCm39)	missense	possibly damaging	0.88
R1518:Plec	UTSW	15	76,072,401 (GRCm39)	missense	probably damaging	0.99
R1584:Plec	UTSW	15	76,070,108 (GRCm39)	missense	possibly damaging	0.88
R1649:Plec	UTSW	15	76,090,011 (GRCm39)	missense	possibly damaging	0.50
R1728:Plec	UTSW	15	76,061,892 (GRCm39)	nonsense	probably null
R1729:Plec	UTSW	15	76,061,892 (GRCm39)	nonsense	probably null
R1734:Plec	UTSW	15	76,070,418 (GRCm39)	missense	probably damaging	0.99
R1736:Plec	UTSW	15	76,070,418 (GRCm39)	missense	probably damaging	0.99
R1738:Plec	UTSW	15	76,070,418 (GRCm39)	missense	probably damaging	0.99
R1744:Plec	UTSW	15	76,070,418 (GRCm39)	missense	probably damaging	0.99
R1819:Plec	UTSW	15	76,064,106 (GRCm39)	missense	probably damaging	1.00
R1850:Plec	UTSW	15	76,072,432 (GRCm39)	missense	probably benign	0.39
R1901:Plec	UTSW	15	76,059,751 (GRCm39)	missense	probably damaging	0.98
R1902:Plec	UTSW	15	76,059,751 (GRCm39)	missense	probably damaging	0.98
R1969:Plec	UTSW	15	76,073,372 (GRCm39)	missense	probably damaging	1.00
R1991:Plec	UTSW	15	76,057,743 (GRCm39)	missense	probably damaging	1.00
R2049:Plec	UTSW	15	76,067,374 (GRCm39)	missense	probably benign	0.39
R2069:Plec	UTSW	15	76,073,126 (GRCm39)	missense	probably benign	0.10
R2103:Plec	UTSW	15	76,057,743 (GRCm39)	missense	probably damaging	1.00
R2140:Plec	UTSW	15	76,067,374 (GRCm39)	missense	probably benign	0.39
R2142:Plec	UTSW	15	76,067,374 (GRCm39)	missense	probably benign	0.39
R2234:Plec	UTSW	15	76,061,147 (GRCm39)	missense	probably damaging	1.00
R2240:Plec	UTSW	15	76,090,250 (GRCm39)	missense	probably damaging	1.00
R2762:Plec	UTSW	15	76,056,486 (GRCm39)	missense	probably damaging	1.00
R2924:Plec	UTSW	15	76,062,452 (GRCm39)	missense	probably damaging	1.00
R2925:Plec	UTSW	15	76,062,452 (GRCm39)	missense	probably damaging	1.00
R2973:Plec	UTSW	15	76,072,961 (GRCm39)	missense	probably damaging	1.00
R2974:Plec	UTSW	15	76,072,961 (GRCm39)	missense	probably damaging	1.00
R4125:Plec	UTSW	15	76,056,962 (GRCm39)	missense	probably damaging	1.00
R4156:Plec	UTSW	15	76,056,453 (GRCm39)	missense	probably damaging	1.00
R4161:Plec	UTSW	15	76,063,851 (GRCm39)	missense	possibly damaging	0.92
R4179:Plec	UTSW	15	76,064,415 (GRCm39)	missense	possibly damaging	0.76
R4180:Plec	UTSW	15	76,064,415 (GRCm39)	missense	possibly damaging	0.76
R4222:Plec	UTSW	15	76,061,519 (GRCm39)	missense	probably damaging	1.00
R4373:Plec	UTSW	15	76,067,317 (GRCm39)	missense	probably damaging	0.99
R4513:Plec	UTSW	15	76,070,418 (GRCm39)	missense	probably damaging	0.99
R4546:Plec	UTSW	15	76,065,757 (GRCm39)	missense	probably benign	0.07
R4577:Plec	UTSW	15	76,068,269 (GRCm39)	missense	possibly damaging	0.55
R4584:Plec	UTSW	15	76,115,406 (GRCm39)	missense	possibly damaging	0.89
R4619:Plec	UTSW	15	76,076,382 (GRCm39)	missense	probably benign	0.00
R4624:Plec	UTSW	15	76,059,335 (GRCm39)	missense	probably damaging	1.00
R4680:Plec	UTSW	15	76,064,775 (GRCm39)	missense	unknown
R4690:Plec	UTSW	15	76,058,456 (GRCm39)	missense	probably damaging	1.00
R4713:Plec	UTSW	15	76,065,267 (GRCm39)	missense	unknown
R4927:Plec	UTSW	15	76,061,162 (GRCm39)	missense	probably damaging	1.00
R4980:Plec	UTSW	15	76,090,065 (GRCm39)	missense	probably damaging	0.97
R4980:Plec	UTSW	15	76,077,495 (GRCm39)	nonsense	probably null
R5141:Plec	UTSW	15	76,074,733 (GRCm39)	missense	probably damaging	1.00
R5191:Plec	UTSW	15	76,059,365 (GRCm39)	missense	probably damaging	1.00
R5214:Plec	UTSW	15	76,061,921 (GRCm39)	missense	probably damaging	1.00
R5260:Plec	UTSW	15	76,060,824 (GRCm39)	missense	probably damaging	1.00
R5276:Plec	UTSW	15	76,057,638 (GRCm39)	missense	probably damaging	1.00
R5291:Plec	UTSW	15	76,058,211 (GRCm39)	missense	probably damaging	1.00
R5293:Plec	UTSW	15	76,083,783 (GRCm39)	missense	probably benign
R5498:Plec	UTSW	15	76,061,654 (GRCm39)	missense	probably damaging	1.00
R5617:Plec	UTSW	15	76,058,732 (GRCm39)	missense	probably damaging	1.00
R5668:Plec	UTSW	15	76,074,666 (GRCm39)	missense	possibly damaging	0.71
R5684:Plec	UTSW	15	76,089,796 (GRCm39)	critical splice donor site	probably null
R5698:Plec	UTSW	15	76,083,808 (GRCm39)	missense	probably benign	0.06
R5707:Plec	UTSW	15	76,083,871 (GRCm39)	intron	probably benign
R5753:Plec	UTSW	15	76,057,620 (GRCm39)	missense	probably damaging	1.00
R5762:Plec	UTSW	15	76,063,455 (GRCm39)	missense	probably damaging	1.00
R5976:Plec	UTSW	15	76,073,237 (GRCm39)	missense	probably damaging	1.00
R5995:Plec	UTSW	15	76,070,105 (GRCm39)	missense	probably damaging	1.00
R6013:Plec	UTSW	15	76,073,510 (GRCm39)	missense	possibly damaging	0.65
R6050:Plec	UTSW	15	76,072,458 (GRCm39)	missense	probably damaging	1.00
R6172:Plec	UTSW	15	76,056,576 (GRCm39)	missense	probably damaging	0.99
R6272:Plec	UTSW	15	76,059,053 (GRCm39)	missense	probably damaging	1.00
R6375:Plec	UTSW	15	76,061,840 (GRCm39)	missense	probably damaging	1.00
R6466:Plec	UTSW	15	76,062,084 (GRCm39)	missense	probably benign	0.03
R6528:Plec	UTSW	15	76,058,630 (GRCm39)	missense	probably damaging	1.00
R6586:Plec	UTSW	15	76,059,287 (GRCm39)	missense	probably damaging	1.00
R6652:Plec	UTSW	15	76,063,974 (GRCm39)	missense	probably damaging	0.97
R6657:Plec	UTSW	15	76,062,356 (GRCm39)	missense	possibly damaging	0.74
R6679:Plec	UTSW	15	76,058,015 (GRCm39)	missense	probably damaging	1.00
R6734:Plec	UTSW	15	76,078,603 (GRCm39)	missense	probably damaging	1.00
R6795:Plec	UTSW	15	76,064,338 (GRCm39)	missense	probably damaging	1.00
R6855:Plec	UTSW	15	76,070,818 (GRCm39)	missense	probably damaging	0.99
R6908:Plec	UTSW	15	76,070,081 (GRCm39)	nonsense	probably null
R6957:Plec	UTSW	15	76,070,414 (GRCm39)	missense	probably damaging	1.00
R6984:Plec	UTSW	15	76,059,527 (GRCm39)	missense	probably damaging	1.00
R7017:Plec	UTSW	15	76,057,741 (GRCm39)	missense	probably damaging	1.00
R7043:Plec	UTSW	15	76,093,328 (GRCm39)	unclassified	probably benign
R7068:Plec	UTSW	15	76,061,969 (GRCm39)	missense	probably damaging	1.00
R7133:Plec	UTSW	15	76,060,227 (GRCm39)	missense	possibly damaging	0.95
R7183:Plec	UTSW	15	76,089,905 (GRCm39)	missense	unknown
R7221:Plec	UTSW	15	76,059,974 (GRCm39)	missense	probably damaging	0.97
R7247:Plec	UTSW	15	76,061,543 (GRCm39)	missense	probably damaging	1.00
R7272:Plec	UTSW	15	76,059,153 (GRCm39)	missense	possibly damaging	0.84
R7346:Plec	UTSW	15	76,082,178 (GRCm39)	critical splice donor site	probably null
R7375:Plec	UTSW	15	76,061,555 (GRCm39)	missense	possibly damaging	0.89
R7396:Plec	UTSW	15	76,059,089 (GRCm39)	missense	probably damaging	1.00
R7505:Plec	UTSW	15	76,065,394 (GRCm39)	missense	unknown
R7530:Plec	UTSW	15	76,069,844 (GRCm39)	missense	unknown
R7576:Plec	UTSW	15	76,071,946 (GRCm39)	missense	unknown
R7585:Plec	UTSW	15	76,057,632 (GRCm39)	missense	probably damaging	1.00
R7627:Plec	UTSW	15	76,061,594 (GRCm39)	missense	probably damaging	1.00
R7630:Plec	UTSW	15	76,074,816 (GRCm39)	splice site	probably null
R7695:Plec	UTSW	15	76,068,055 (GRCm39)	nonsense	probably null
R7697:Plec	UTSW	15	76,065,885 (GRCm39)	missense	unknown
R7718:Plec	UTSW	15	76,061,639 (GRCm39)	missense	probably damaging	1.00
R7762:Plec	UTSW	15	76,067,823 (GRCm39)	missense	unknown
R7775:Plec	UTSW	15	76,061,135 (GRCm39)	missense	probably damaging	1.00
R7778:Plec	UTSW	15	76,061,135 (GRCm39)	missense	probably damaging	1.00
R7785:Plec	UTSW	15	76,090,029 (GRCm39)	missense	unknown
R7787:Plec	UTSW	15	76,083,811 (GRCm39)	missense	unknown
R7839:Plec	UTSW	15	76,060,583 (GRCm39)	missense	probably damaging	1.00
R7893:Plec	UTSW	15	76,056,732 (GRCm39)	missense	possibly damaging	0.57
R8036:Plec	UTSW	15	76,063,380 (GRCm39)	missense	possibly damaging	0.46
R8079:Plec	UTSW	15	76,063,750 (GRCm39)	nonsense	probably null
R8132:Plec	UTSW	15	76,074,773 (GRCm39)	missense	unknown
R8139:Plec	UTSW	15	76,058,510 (GRCm39)	missense	probably damaging	0.99
R8214:Plec	UTSW	15	76,076,484 (GRCm39)	missense	unknown
R8220:Plec	UTSW	15	76,062,497 (GRCm39)	missense	possibly damaging	0.94
R8222:Plec	UTSW	15	76,063,374 (GRCm39)	missense	possibly damaging	0.94
R8303:Plec	UTSW	15	76,073,466 (GRCm39)	missense	unknown
R8471:Plec	UTSW	15	76,070,620 (GRCm39)	missense	probably damaging	1.00
R8670:Plec	UTSW	15	76,061,726 (GRCm39)	missense	probably damaging	1.00
R8711:Plec	UTSW	15	76,059,531 (GRCm39)	missense	probably benign	0.45
R8765:Plec	UTSW	15	76,066,045 (GRCm39)	missense	unknown
R8896:Plec	UTSW	15	76,078,560 (GRCm39)	missense	unknown
R8897:Plec	UTSW	15	76,057,598 (GRCm39)	missense	probably damaging	1.00
R8951:Plec	UTSW	15	76,067,310 (GRCm39)	nonsense	probably null
R9008:Plec	UTSW	15	76,060,232 (GRCm39)	missense	probably damaging	1.00
R9081:Plec	UTSW	15	76,059,908 (GRCm39)	missense	probably damaging	0.98
R9085:Plec	UTSW	15	76,057,275 (GRCm39)	missense	probably damaging	1.00
R9153:Plec	UTSW	15	76,064,725 (GRCm39)	missense	unknown
R9198:Plec	UTSW	15	76,069,937 (GRCm39)	missense	unknown
R9207:Plec	UTSW	15	76,058,117 (GRCm39)	missense	probably damaging	1.00
R9235:Plec	UTSW	15	76,059,701 (GRCm39)	missense	probably damaging	1.00
R9276:Plec	UTSW	15	76,060,445 (GRCm39)	missense	probably benign	0.42
R9428:Plec	UTSW	15	76,067,721 (GRCm39)	critical splice donor site	probably null
R9451:Plec	UTSW	15	76,067,987 (GRCm39)	missense	unknown
R9511:Plec	UTSW	15	76,058,897 (GRCm39)	missense	probably damaging	1.00
R9521:Plec	UTSW	15	76,062,924 (GRCm39)	missense	possibly damaging	0.83
R9528:Plec	UTSW	15	76,061,033 (GRCm39)	missense	possibly damaging	0.89
R9566:Plec	UTSW	15	76,062,790 (GRCm39)	missense	possibly damaging	0.66
R9576:Plec	UTSW	15	76,115,377 (GRCm39)	missense	probably benign	0.00
R9605:Plec	UTSW	15	76,065,213 (GRCm39)	missense	unknown
R9643:Plec	UTSW	15	76,058,177 (GRCm39)	missense	probably damaging	0.99
R9649:Plec	UTSW	15	76,067,153 (GRCm39)	missense	unknown
U24488:Plec	UTSW	15	76,061,930 (GRCm39)	missense	probably benign	0.15
X0028:Plec	UTSW	15	76,057,435 (GRCm39)	missense	probably damaging	1.00
X0061:Plec	UTSW	15	76,059,099 (GRCm39)	missense	probably damaging	1.00
Z1177:Plec	UTSW	15	76,065,407 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTGTTGCAACAAGAAGCCAGAC -3'
(R):5'- CATGTCAGGGGAGGATTCTGAG -3'

Sequencing Primer
(F):5'- GACGTCAGCTCTTTAAAAGTCC -3'
(R):5'- ATTCTGAGGTCCGGCCAGTG -3'

Posted On

2022-05-16