Incidental Mutation 'R9424:Triobp'
ID 712526
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9424 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 78947724-79005869 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78960066 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 161 (S161P)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228] [ENSMUST00000229943]
AlphaFold Q99KW3
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: S161P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: S161P

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109690
AA Change: S161P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: S161P

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140228
AA Change: S161P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000229943
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T A 15: 82,063,642 I580N probably benign Het
Adam9 C A 8: 24,955,937 V814F probably benign Het
Aipl1 C T 11: 72,037,427 G11D probably damaging Het
Ak2 A G 4: 129,002,402 E120G possibly damaging Het
Akap9 C A 5: 3,962,223 Y975* probably null Het
Akap9 C T 5: 3,962,224 Q976* probably null Het
Bpnt1 T C 1: 185,338,138 M9T possibly damaging Het
C4bp C A 1: 130,657,175 L41F probably damaging Het
Car3 A T 3: 14,864,390 I59F Het
Card11 T C 5: 140,908,640 D78G probably damaging Het
Ccdc125 A G 13: 100,684,368 D199G possibly damaging Het
Ccdc88c T C 12: 100,945,490 D695G possibly damaging Het
Cd48 T A 1: 171,704,864 I237N possibly damaging Het
Cep295 T C 9: 15,333,203 E1319G probably damaging Het
Col6a4 C A 9: 106,068,072 A948S probably benign Het
Dcp1b T A 6: 119,220,032 Y563* probably null Het
Dcp2 C T 18: 44,405,294 R173C probably damaging Het
Ddx59 T A 1: 136,416,943 Y117* probably null Het
Dennd2a A T 6: 39,508,360 Y328* probably null Het
Dhx30 A G 9: 110,087,644 L601P probably damaging Het
Dip2c A G 13: 9,659,395 T1424A probably damaging Het
Dlg2 A G 7: 92,431,117 N733S probably damaging Het
Dnah5 C T 15: 28,272,140 T1030M probably benign Het
Fgd5 A T 6: 91,979,036 R3* probably null Het
Gbf1 A T 19: 46,259,683 T300S probably benign Het
Gm5591 A T 7: 38,520,297 L384Q probably damaging Het
Grm5 C T 7: 88,116,276 A904V probably benign Het
Havcr1 T A 11: 46,778,564 V290E probably benign Het
Hspb7 A G 4: 141,421,930 D49G possibly damaging Het
Itpr2 A T 6: 146,311,007 I1537N probably damaging Het
Kalrn T C 16: 33,988,818 T2567A probably benign Het
Kat8 T C 7: 127,924,928 L380S probably benign Het
Krt2 T A 15: 101,811,357 Y626F unknown Het
Lrrk2 T A 15: 91,752,185 L1454* probably null Het
Mgat4a C A 1: 37,490,355 V148F probably damaging Het
Mtg1 T A 7: 140,147,299 Y238* probably null Het
Neb T A 2: 52,151,398 Q6807L probably benign Het
Nlrp9a C A 7: 26,560,753 F644L probably benign Het
Pcdhb15 A G 18: 37,474,210 N165S Het
Pcdhb5 C A 18: 37,321,067 Q167K probably damaging Het
Per1 T A 11: 69,108,029 M1142K probably damaging Het
Piezo1 A G 8: 122,491,340 V1220A Het
Pkd1l1 T C 11: 8,870,091 T1713A Het
Plec C A 15: 76,231,177 A66S probably benign Het
Ppfia4 C A 1: 134,319,306 V559F possibly damaging Het
Ppil6 T C 10: 41,503,028 S224P probably damaging Het
Ppp2r2d T A 7: 138,874,249 M262K possibly damaging Het
Prl7d1 A T 13: 27,710,202 M127K probably benign Het
Rassf9 T A 10: 102,545,716 C320S probably benign Het
Rbm19 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 5: 120,140,280 probably benign Het
Rin3 T A 12: 102,369,330 L420* probably null Het
Serpina3i A G 12: 104,268,471 T354A probably benign Het
Serpinb9b A G 13: 33,029,561 S34G probably damaging Het
Slc19a2 T C 1: 164,249,326 V25A probably damaging Het
Slc1a2 G A 2: 102,761,049 E375K probably damaging Het
Slfn9 T A 11: 82,987,385 Y306F possibly damaging Het
Sparcl1 A T 5: 104,093,164 D131E possibly damaging Het
Srl A T 16: 4,483,167 L680Q probably damaging Het
Sufu G A 19: 46,485,881 W465* probably null Het
Szt2 A G 4: 118,390,954 L691P probably damaging Het
Tbc1d4 A T 14: 101,465,660 I783N probably damaging Het
Tmem191c C T 16: 17,276,662 R62* probably null Het
Tmem217 C A 17: 29,526,716 M13I possibly damaging Het
Trp53bp2 T C 1: 182,446,299 V503A possibly damaging Het
Tspoap1 G A 11: 87,761,256 probably benign Het
Ttn T C 2: 76,752,003 T22849A probably damaging Het
Ugt2b37 A T 5: 87,254,358 M138K probably damaging Het
Uimc1 A T 13: 55,075,833 F209I possibly damaging Het
Vipr1 G A 9: 121,642,927 probably null Het
Wdr91 A T 6: 34,884,367 N633K possibly damaging Het
Zfp618 T C 4: 63,133,045 S688P probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7688:Triobp UTSW 15 78961111 splice site probably null
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7972:Triobp UTSW 15 78967986 missense probably damaging 1.00
R7977:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7987:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7999:Triobp UTSW 15 78959944 missense probably damaging 0.99
R8344:Triobp UTSW 15 78958275 missense possibly damaging 0.67
R8348:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8446:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8448:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8469:Triobp UTSW 15 78967019 missense probably benign 0.00
R8491:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8492:Triobp UTSW 15 78994126 missense possibly damaging 0.85
R8493:Triobp UTSW 15 78994126 missense possibly damaging 0.85
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF005:Triobp UTSW 15 78967061 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAACACGCCCACATGTAG -3'
(R):5'- AAGTCCCTATGCACTGAGCC -3'

Sequencing Primer
(F):5'- GAAGGGAAAGTCATTGATCTCTCTCC -3'
(R):5'- TATGCACTGAGCCCCACG -3'
Posted On 2022-05-16