Mutagenetix > Incidental Mutation

Incidental Mutation 'R9425:Upf1'

712574

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R9425 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70339353 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 418 (D418E)

Ref Sequence

ENSEMBL: ENSMUSP00000075089 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably benign
Transcript: ENSMUST00000075666
AA Change: D418E

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: D418E

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215817
AA Change: D407E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	C	3: 122,132,695	S1260T	probably damaging	Het
Adgra2	A	G	8: 27,086,066	I41V	probably benign	Het
Adgrf1	A	G	17: 43,310,383	I504V	possibly damaging	Het
Agtrap	A	G	4: 148,080,562	I136T	probably damaging	Het
Arhgef7	C	T	8: 11,817,736	T601I	probably damaging	Het
Asb7	T	C	7: 66,679,239	I18V	possibly damaging	Het
C1rl	T	C	6: 124,508,363	V231A	probably benign	Het
Cachd1	A	T	4: 100,974,860	T740S	probably benign	Het
Ccdc146	T	A	5: 21,303,137	I638F	probably damaging	Het
Ccser2	T	C	14: 36,879,206	N407S	probably benign	Het
Clec7a	G	A	6: 129,465,551	S126L	probably damaging	Het
Copb1	C	T	7: 114,248,947	G118R	probably damaging	Het
Cpne3	A	T	4: 19,525,148	M449K	probably damaging	Het
Cttnbp2	A	T	6: 18,423,881	C815S	probably damaging	Het
Cyp27b1	T	C	10: 127,050,137	L253P	probably damaging	Het
Cyp3a44	C	A	5: 145,803,738	G31*	probably null	Het
Dcp2	C	T	18: 44,405,294	R173C	probably damaging	Het
Dmgdh	A	T	13: 93,744,305	I748L	probably benign	Het
Drc1	T	A	5: 30,345,594	W154R	probably benign	Het
E330034G19Rik	T	A	14: 24,308,319		probably null	Het
Gbp7	T	A	3: 142,542,957	V327E	probably damaging	Het
Gm11564	G	A	11: 99,815,239	P122S	unknown	Het
Grid2ip	C	A	5: 143,381,680	S615R		Het
Kcp	T	A	6: 29,489,152	Q1045L	probably benign	Het
Lgals3bp	T	A	11: 118,393,925	E276V	probably damaging	Het
Lrit1	T	C	14: 37,062,251	V512A	possibly damaging	Het
Mecom	T	A	3: 29,985,448	H154L	probably benign	Het
Mmp14	C	A	14: 54,440,347	T475K	probably damaging	Het
Mmp1a	T	G	9: 7,476,209	F436V	probably damaging	Het
Notch4	A	G	17: 34,576,827	S830G	probably benign	Het
Oas1b	T	C	5: 120,817,628	L158P	probably benign	Het
Odf4	A	G	11: 68,922,984	V126A	probably benign	Het
Olfml2a	A	G	2: 38,957,709	T427A	probably damaging	Het
Olfr1189	C	A	2: 88,592,533	T243K	probably damaging	Het
Olfr1367	A	G	13: 21,347,303	Y125C	probably damaging	Het
Olfr1480	C	T	19: 13,529,858	L106F	probably damaging	Het
Olfr212	G	A	6: 116,516,613	E279K	possibly damaging	Het
Olfr901	A	G	9: 38,430,990	K236R	possibly damaging	Het
Panx3	G	A	9: 37,661,097	H386Y	probably benign	Het
Papss1	C	A	3: 131,564,947	C8*	probably null	Het
Papss2	G	T	19: 32,638,350	V161L	possibly damaging	Het
Pcdh18	G	T	3: 49,754,602	H755N	possibly damaging	Het
Pilrb2	G	C	5: 137,868,702	H180D	probably benign	Het
Pla2g4f	T	C	2: 120,302,783	D645G	possibly damaging	Het
Pnlip	A	T	19: 58,680,858	K430*	probably null	Het
Ralbp1	C	A	17: 65,864,511	A156S	possibly damaging	Het
Rnf4	C	T	5: 34,351,297	R168C	probably benign	Het
Slc17a5	C	T	9: 78,577,175	G127E	probably damaging	Het
Slc22a27	A	T	19: 7,896,791	N306K	probably damaging	Het
Slc5a9	G	A	4: 111,877,606	R664C	probably damaging	Het
Slco1b2	T	A	6: 141,657,523	I210K	possibly damaging	Het
Snx16	C	T	3: 10,434,460	R170H	probably damaging	Het
Speer4e	T	C	5: 14,937,122	I90V	possibly damaging	Het
Stxbp5l	T	C	16: 37,174,344	D733G	possibly damaging	Het
Tbc1d24	A	G	17: 24,185,408	V254A	probably benign	Het
Tmf1	A	G	6: 97,172,332	F485L	probably benign	Het
Tnks	G	A	8: 34,873,665	L396F	probably damaging	Het
Trabd	T	C	15: 89,085,293	C230R	probably damaging	Het
Trp53rkb	C	T	2: 166,795,622	A166V	probably benign	Het
Ust	A	C	10: 8,330,109	S137A	probably damaging	Het
Zfp513	T	A	5: 31,200,351	H228L	possibly damaging	Het
Zfp827	C	A	8: 79,178,959	A855E	probably damaging	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5748:Upf1	UTSW	8	70338517	missense	probably damaging	1.00
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAGCAGCTTGTGGTAAATATAC -3'
(R):5'- TGTGTGAGTGAAACAGCCTGG -3'

Sequencing Primer
(F):5'- TATACCCTGACACAGAGGTCTCGTC -3'
(R):5'- TGAAACAGCCTGGAGTCTGTC -3'

Posted On

2022-05-16