Incidental Mutation 'R9428:Scube2'
ID 712737
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock # R9428 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109798676-109865679 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109829138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 509 (D509E)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect possibly damaging
Transcript: ENSMUST00000007423
AA Change: D481E

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: D481E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106728
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106729
AA Change: D509E

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: D509E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agmo A G 12: 37,405,331 I281M probably benign Het
Ahdc1 C T 4: 133,064,462 P1005S possibly damaging Het
Akap12 T A 10: 4,353,409 V178D probably damaging Het
Arc A G 15: 74,671,214 S387P probably benign Het
Arhgap11a C T 2: 113,836,934 V423I probably benign Het
Arhgap44 A G 11: 65,008,342 S670P probably damaging Het
C4b G A 17: 34,730,911 T1433M possibly damaging Het
C4bp A T 1: 130,653,357 F138L probably benign Het
Carmil1 A T 13: 24,111,851 C393* probably null Het
Celsr1 A T 15: 85,931,348 V1822E possibly damaging Het
Chgb C G 2: 132,793,234 S365R probably damaging Het
Cnih3 T C 1: 181,353,292 probably benign Het
Dcaf1 T A 9: 106,858,329 D825E possibly damaging Het
Dlx3 T C 11: 95,120,604 Y95H probably benign Het
Dmbt1 A T 7: 131,066,478 E488V unknown Het
E330014E10Rik G T 5: 95,801,686 R97S probably damaging Het
Espnl A G 1: 91,345,873 Y985C probably damaging Het
Fam109a C T 5: 121,853,084 P170S possibly damaging Het
Frmpd2 T C 14: 33,550,053 V1048A probably damaging Het
Fxn A T 19: 24,272,423 L100Q probably damaging Het
Gapvd1 T A 2: 34,717,306 D560V probably damaging Het
Gif A G 19: 11,757,738 T241A probably benign Het
Gm4924 T A 10: 82,377,656 H429Q unknown Het
Gm498 G T 7: 143,881,165 probably null Het
Gm6169 A G 13: 97,099,216 S8P probably benign Het
Gpr158 T C 2: 21,783,161 F538L probably benign Het
Itpr1 T A 6: 108,401,347 M1278K possibly damaging Het
Ivd T A 2: 118,877,888 V361E probably damaging Het
Kcnh6 T C 11: 106,008,995 L30P probably damaging Het
Lipo4 C T 19: 33,517,674 V35I probably benign Het
Lmo7 A G 14: 101,917,640 D1200G probably damaging Het
Med1 T A 11: 98,189,223 R31* probably null Het
Mill2 A T 7: 18,840,025 R12* probably null Het
Mphosph8 A G 14: 56,696,657 probably null Het
Mtfr2 T A 10: 20,357,293 S203T possibly damaging Het
Muc5ac A C 7: 141,808,822 T1957P unknown Het
Mxi1 C A 19: 53,310,782 P28Q probably benign Het
Mycbpap T C 11: 94,503,169 D367G probably damaging Het
Nav3 T C 10: 109,769,315 T966A probably benign Het
Nbea AC A 3: 56,090,972 probably null Het
Ndst2 A T 14: 20,725,402 F673L possibly damaging Het
Ndst3 T A 3: 123,546,869 I767F probably benign Het
Nell1 A T 7: 50,853,935 D696V probably damaging Het
Nol9 A T 4: 152,039,652 T100S probably benign Het
Nr4a1 T C 15: 101,270,364 S94P probably damaging Het
Nrd1 T C 4: 109,000,924 I31T probably damaging Het
Oas2 T A 5: 120,749,511 D88V probably damaging Het
Olfr1132 T C 2: 87,635,430 I106V probably benign Het
Pex6 A G 17: 46,712,065 H189R probably benign Het
Pgap1 A G 1: 54,536,047 S239P probably damaging Het
Plec A G 15: 76,183,521 probably null Het
Plekhg5 T C 4: 152,108,323 V582A probably benign Het
Plekhh2 G T 17: 84,566,413 E375D probably benign Het
Psmd4 G A 3: 95,033,456 T332I probably benign Het
Ptprc T A 1: 138,113,747 T76S probably benign Het
Rab44 A T 17: 29,139,341 I168L Het
Ros1 T C 10: 52,081,965 T1872A probably benign Het
Scgb1b24 A T 7: 33,744,068 K51* probably null Het
Sgo2b A T 8: 63,940,033 S123R probably damaging Het
Smc3 G C 19: 53,628,719 R521P possibly damaging Het
Socs4 G A 14: 47,290,577 R323H probably damaging Het
Socs5 T A 17: 87,133,639 D2E probably benign Het
Sra1 A G 18: 36,677,246 V121A probably damaging Het
Tanc1 T C 2: 59,771,204 L143P probably damaging Het
Tcerg1l A T 7: 138,209,761 F568Y probably damaging Het
Tmem110 T C 14: 30,872,688 S253P probably benign Het
Trpm7 T C 2: 126,829,220 E614G probably damaging Het
Tuba4a G T 1: 75,216,042 H337Q Het
Tubgcp6 G A 15: 89,100,897 H1663Y probably damaging Het
Ush2a A G 1: 188,443,119 Y1138C probably damaging Het
Vmn1r18 A T 6: 57,390,550 N6K possibly damaging Het
Vmn1r213 G A 13: 23,011,774 A176T Het
Vmn1r215 A T 13: 23,076,579 H263L probably benign Het
Vmn2r51 CGGCCAATAGAAGAAACTTTTACCTTCAAGCAGTGAGAACTGGC CGGC 7: 10,099,785 probably benign Het
Wdhd1 A C 14: 47,251,970 L702* probably null Het
Zc3h12a T C 4: 125,126,765 E95G probably benign Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
R8197:Scube2 UTSW 7 109808477 missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8273:Scube2 UTSW 7 109809176 missense probably benign 0.00
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
R8882:Scube2 UTSW 7 109852473 missense probably damaging 1.00
R9258:Scube2 UTSW 7 109799308 missense probably damaging 1.00
R9476:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9510:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9709:Scube2 UTSW 7 109831764 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAACATGTGCTTGCACTCAG -3'
(R):5'- TCTCTTGAGATAGGGGAGGC -3'

Sequencing Primer
(F):5'- TTGCACTCAGCTAGTCACAGG -3'
(R):5'- CTCTTGAGATAGGGGAGGCTCTAG -3'
Posted On 2022-05-16