Mutagenetix > Incidental Mutations

Incidental Mutation 'R9429:Mroh2b'

712834

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R9429 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4934425 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 833 (L833Q)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably damaging
Transcript: ENSMUST00000045736
AA Change: L833Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: L833Q

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	C	19: 7,422,229	L447P	probably damaging	Het
5430403G16Rik	A	T	5: 109,676,468	L372*	probably null	Het
5930422O12Rik	A	T	8: 33,429,137		probably benign	Het
Adam7	G	C	14: 68,533,631	H15Q	probably null	Het
Adgrv1	A	T	13: 81,419,349	I5235N	probably damaging	Het
Adgrv1	A	C	13: 81,593,046	C100G	probably damaging	Het
Aebp1	A	G	11: 5,871,649	T1063A	probably benign	Het
Atmin	A	G	8: 116,943,568	R48G	probably benign	Het
Atxn10	A	G	15: 85,462,364	E441G	probably benign	Het
Catsper1	T	C	19: 5,339,727	V505A	possibly damaging	Het
Chd5	T	C	4: 152,362,907	V471A	probably damaging	Het
Cma2	A	G	14: 55,972,819	I110V	possibly damaging	Het
Cnst	A	C	1: 179,605,001	N243T	probably damaging	Het
Col15a1	A	T	4: 47,310,439	N1203I	probably damaging	Het
Col6a3	T	A	1: 90,803,863	H1556L	probably benign	Het
Crybg3	T	A	16: 59,555,193	K185N	probably benign	Het
Dnah1	G	A	14: 31,275,542	Q2620*	probably null	Het
Dusp10	A	C	1: 184,068,894	D286A	probably benign	Het
Erich6	A	G	3: 58,629,514	V252A	possibly damaging	Het
Fhod1	A	G	8: 105,330,507	L945P	probably damaging	Het
Foxh1	C	T	15: 76,669,242	R120Q	probably null	Het
Frmd4b	T	C	6: 97,302,291	D591G	probably damaging	Het
Gbe1	G	A	16: 70,495,315	V512I	probably benign	Het
Ghitm	A	G	14: 37,130,698	S142P	probably damaging	Het
Gldc	C	T	19: 30,113,772	A808T	possibly damaging	Het
Gm14496	C	T	2: 181,996,141	T336I	possibly damaging	Het
Gm38394	A	C	1: 133,657,715	I628R	probably damaging	Het
Gm498	G	T	7: 143,881,165		probably null	Het
Ido2	T	C	8: 24,547,178	T171A	probably damaging	Het
Kctd19	A	T	8: 105,383,020	I930N	probably damaging	Het
Kctd2	T	C	11: 115,427,451	Y187H	probably damaging	Het
L3hypdh	T	C	12: 72,077,429	T246A	probably damaging	Het
Lama1	A	G	17: 67,811,454	M2554V		Het
Laptm5	A	G	4: 130,928,650	Y93C		Het
Ms4a12	T	C	19: 11,216,060	D187G	probably damaging	Het
Muc4	C	T	16: 32,755,724	T1866I	unknown	Het
Myo1a	G	T	10: 127,707,378	D168Y	probably damaging	Het
Nek1	C	T	8: 61,106,858	S1005L	probably benign	Het
Nrg1	T	A	8: 31,818,564	M523L	probably benign	Het
Nt5c2	T	A	19: 46,889,020	H494L	probably benign	Het
Oasl2	G	A	5: 114,904,979	V271I	probably benign	Het
Olfr211	T	G	6: 116,494,331	S241A	probably damaging	Het
Olfr513	G	T	7: 108,755,205	M116I	probably damaging	Het
Olfr593	C	T	7: 103,212,664	A268V	possibly damaging	Het
Per2	T	C	1: 91,423,767	T1006A	probably benign	Het
Phyhd1	C	A	2: 30,266,905	F19L	probably benign	Het
Pter	T	A	2: 12,980,301	D147E	probably benign	Het
Rps6ka1	A	C	4: 133,871,589	L90V	probably damaging	Het
Rrp15	A	T	1: 186,749,171	D46E	probably benign	Het
Ryr2	A	G	13: 11,794,573	F789L	probably damaging	Het
Sepsecs	T	C	5: 52,643,952	K456R	probably benign	Het
Sept11	G	A	5: 93,173,538		probably null	Het
Sowahb	T	C	5: 93,043,221	I546M	possibly damaging	Het
Spata31	C	A	13: 64,922,522	T828K	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Ston1	A	G	17: 88,635,606	T147A	probably benign	Het
Tcf3	G	A	10: 80,416,602	P350S	probably benign	Het
Tek	A	G	4: 94,827,278	D402G	probably benign	Het
Themis3	T	C	17: 66,559,670	R192G	probably damaging	Het
Tmc1	T	A	19: 20,816,184	I538F	possibly damaging	Het
Trpc3	T	G	3: 36,651,628	I473L	probably benign	Het
Ttll2	A	T	17: 7,352,686	L4Q	probably damaging	Het
Urb2	T	A	8: 124,023,487	Y5*	probably null	Het
Vav3	T	A	3: 109,657,245	Y673*	probably null	Het
Vmn1r32	T	A	6: 66,553,253	T180S	probably benign	Het
Vmn1r90	A	T	7: 14,561,722	N150K	probably damaging	Het
Zfp72	A	G	13: 74,372,584	I125T	probably damaging	Het
Zfp750	G	A	11: 121,513,867	R61C	probably damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R7995:Mroh2b	UTSW	15	4921357	nonsense	probably null
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAAGAGCAATGGATCCCCTG -3'
(R):5'- AGCGTTCGTAGAGAAACTGAAATC -3'

Sequencing Primer
(F):5'- AGAGCAATGGATCCCCTGTATCTG -3'
(R):5'- ACTGAAATCAAGTGTGACTGTTAG -3'

Posted On

2022-05-16