Incidental Mutation 'R9429:Mroh2b'
ID 712834
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Name maestro heat-like repeat family member 2B
Synonyms 4930455B06Rik, Heatr7b2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock # R9429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 4898737-4962205 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 4934425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 833 (L833Q)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
AlphaFold Q7M6Y6
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: L833Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: L833Q

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,229 L447P probably damaging Het
5430403G16Rik A T 5: 109,676,468 L372* probably null Het
5930422O12Rik A T 8: 33,429,137 probably benign Het
Adam7 G C 14: 68,533,631 H15Q probably null Het
Adgrv1 A T 13: 81,419,349 I5235N probably damaging Het
Adgrv1 A C 13: 81,593,046 C100G probably damaging Het
Aebp1 A G 11: 5,871,649 T1063A probably benign Het
Atmin A G 8: 116,943,568 R48G probably benign Het
Atxn10 A G 15: 85,462,364 E441G probably benign Het
Catsper1 T C 19: 5,339,727 V505A possibly damaging Het
Chd5 T C 4: 152,362,907 V471A probably damaging Het
Cma2 A G 14: 55,972,819 I110V possibly damaging Het
Cnst A C 1: 179,605,001 N243T probably damaging Het
Col15a1 A T 4: 47,310,439 N1203I probably damaging Het
Col6a3 T A 1: 90,803,863 H1556L probably benign Het
Crybg3 T A 16: 59,555,193 K185N probably benign Het
Dnah1 G A 14: 31,275,542 Q2620* probably null Het
Dusp10 A C 1: 184,068,894 D286A probably benign Het
Erich6 A G 3: 58,629,514 V252A possibly damaging Het
Fhod1 A G 8: 105,330,507 L945P probably damaging Het
Foxh1 C T 15: 76,669,242 R120Q probably null Het
Frmd4b T C 6: 97,302,291 D591G probably damaging Het
Gbe1 G A 16: 70,495,315 V512I probably benign Het
Ghitm A G 14: 37,130,698 S142P probably damaging Het
Gldc C T 19: 30,113,772 A808T possibly damaging Het
Gm14496 C T 2: 181,996,141 T336I possibly damaging Het
Gm38394 A C 1: 133,657,715 I628R probably damaging Het
Gm498 G T 7: 143,881,165 probably null Het
Ido2 T C 8: 24,547,178 T171A probably damaging Het
Kctd19 A T 8: 105,383,020 I930N probably damaging Het
Kctd2 T C 11: 115,427,451 Y187H probably damaging Het
L3hypdh T C 12: 72,077,429 T246A probably damaging Het
Lama1 A G 17: 67,811,454 M2554V Het
Laptm5 A G 4: 130,928,650 Y93C Het
Ms4a12 T C 19: 11,216,060 D187G probably damaging Het
Muc4 C T 16: 32,755,724 T1866I unknown Het
Myo1a G T 10: 127,707,378 D168Y probably damaging Het
Nek1 C T 8: 61,106,858 S1005L probably benign Het
Nrg1 T A 8: 31,818,564 M523L probably benign Het
Nt5c2 T A 19: 46,889,020 H494L probably benign Het
Oasl2 G A 5: 114,904,979 V271I probably benign Het
Olfr211 T G 6: 116,494,331 S241A probably damaging Het
Olfr513 G T 7: 108,755,205 M116I probably damaging Het
Olfr593 C T 7: 103,212,664 A268V possibly damaging Het
Per2 T C 1: 91,423,767 T1006A probably benign Het
Phyhd1 C A 2: 30,266,905 F19L probably benign Het
Pter T A 2: 12,980,301 D147E probably benign Het
Rps6ka1 A C 4: 133,871,589 L90V probably damaging Het
Rrp15 A T 1: 186,749,171 D46E probably benign Het
Ryr2 A G 13: 11,794,573 F789L probably damaging Het
Sepsecs T C 5: 52,643,952 K456R probably benign Het
Sept11 G A 5: 93,173,538 probably null Het
Sowahb T C 5: 93,043,221 I546M possibly damaging Het
Spata31 C A 13: 64,922,522 T828K probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Ston1 A G 17: 88,635,606 T147A probably benign Het
Tcf3 G A 10: 80,416,602 P350S probably benign Het
Tek A G 4: 94,827,278 D402G probably benign Het
Themis3 T C 17: 66,559,670 R192G probably damaging Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Trpc3 T G 3: 36,651,628 I473L probably benign Het
Ttll2 A T 17: 7,352,686 L4Q probably damaging Het
Urb2 T A 8: 124,023,487 Y5* probably null Het
Vav3 T A 3: 109,657,245 Y673* probably null Het
Vmn1r32 T A 6: 66,553,253 T180S probably benign Het
Vmn1r90 A T 7: 14,561,722 N150K probably damaging Het
Zfp72 A G 13: 74,372,584 I125T probably damaging Het
Zfp750 G A 11: 121,513,867 R61C probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
R8728:Mroh2b UTSW 15 4905640 missense probably damaging 1.00
R8747:Mroh2b UTSW 15 4935300 missense probably damaging 0.99
R8798:Mroh2b UTSW 15 4948709 missense probably damaging 1.00
R8814:Mroh2b UTSW 15 4941625 missense possibly damaging 0.61
R8856:Mroh2b UTSW 15 4931028 nonsense probably null
R8910:Mroh2b UTSW 15 4931373 missense probably benign 0.01
R8913:Mroh2b UTSW 15 4917528 intron probably benign
R8941:Mroh2b UTSW 15 4962124 missense possibly damaging 0.86
R9014:Mroh2b UTSW 15 4899188 start codon destroyed probably null 0.95
R9086:Mroh2b UTSW 15 4953272 critical splice acceptor site probably null
R9101:Mroh2b UTSW 15 4900453 missense probably benign 0.20
R9118:Mroh2b UTSW 15 4962091 missense possibly damaging 0.86
R9393:Mroh2b UTSW 15 4951184 missense probably benign
R9431:Mroh2b UTSW 15 4934470 missense probably damaging 1.00
R9443:Mroh2b UTSW 15 4944339 missense probably damaging 1.00
R9447:Mroh2b UTSW 15 4931341 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGAGCAATGGATCCCCTG -3'
(R):5'- AGCGTTCGTAGAGAAACTGAAATC -3'

Sequencing Primer
(F):5'- AGAGCAATGGATCCCCTGTATCTG -3'
(R):5'- ACTGAAATCAAGTGTGACTGTTAG -3'
Posted On 2022-05-16