Incidental Mutation 'R9429:Tmc1'
ID 712847
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Name transmembrane channel-like gene family 1
Synonyms 4933416G09Rik, Beethoven, Bth
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9429 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 20783458-20954202 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20816184 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 538 (I538F)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
AlphaFold Q8R4P5
Predicted Effect possibly damaging
Transcript: ENSMUST00000039500
AA Change: I538F

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: I538F

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Meta Mutation Damage Score 0.3686 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik T C 19: 7,422,229 L447P probably damaging Het
5430403G16Rik A T 5: 109,676,468 L372* probably null Het
5930422O12Rik A T 8: 33,429,137 probably benign Het
Adam7 G C 14: 68,533,631 H15Q probably null Het
Adgrv1 A T 13: 81,419,349 I5235N probably damaging Het
Adgrv1 A C 13: 81,593,046 C100G probably damaging Het
Aebp1 A G 11: 5,871,649 T1063A probably benign Het
Atmin A G 8: 116,943,568 R48G probably benign Het
Atxn10 A G 15: 85,462,364 E441G probably benign Het
Catsper1 T C 19: 5,339,727 V505A possibly damaging Het
Chd5 T C 4: 152,362,907 V471A probably damaging Het
Cma2 A G 14: 55,972,819 I110V possibly damaging Het
Cnst A C 1: 179,605,001 N243T probably damaging Het
Col15a1 A T 4: 47,310,439 N1203I probably damaging Het
Col6a3 T A 1: 90,803,863 H1556L probably benign Het
Crybg3 T A 16: 59,555,193 K185N probably benign Het
Dnah1 G A 14: 31,275,542 Q2620* probably null Het
Dusp10 A C 1: 184,068,894 D286A probably benign Het
Erich6 A G 3: 58,629,514 V252A possibly damaging Het
Fhod1 A G 8: 105,330,507 L945P probably damaging Het
Foxh1 C T 15: 76,669,242 R120Q probably null Het
Frmd4b T C 6: 97,302,291 D591G probably damaging Het
Gbe1 G A 16: 70,495,315 V512I probably benign Het
Ghitm A G 14: 37,130,698 S142P probably damaging Het
Gldc C T 19: 30,113,772 A808T possibly damaging Het
Gm14496 C T 2: 181,996,141 T336I possibly damaging Het
Gm38394 A C 1: 133,657,715 I628R probably damaging Het
Gm498 G T 7: 143,881,165 probably null Het
Ido2 T C 8: 24,547,178 T171A probably damaging Het
Kctd19 A T 8: 105,383,020 I930N probably damaging Het
Kctd2 T C 11: 115,427,451 Y187H probably damaging Het
L3hypdh T C 12: 72,077,429 T246A probably damaging Het
Lama1 A G 17: 67,811,454 M2554V Het
Laptm5 A G 4: 130,928,650 Y93C Het
Mroh2b T A 15: 4,934,425 L833Q probably damaging Het
Ms4a12 T C 19: 11,216,060 D187G probably damaging Het
Muc4 C T 16: 32,755,724 T1866I unknown Het
Myo1a G T 10: 127,707,378 D168Y probably damaging Het
Nek1 C T 8: 61,106,858 S1005L probably benign Het
Nrg1 T A 8: 31,818,564 M523L probably benign Het
Nt5c2 T A 19: 46,889,020 H494L probably benign Het
Oasl2 G A 5: 114,904,979 V271I probably benign Het
Olfr211 T G 6: 116,494,331 S241A probably damaging Het
Olfr513 G T 7: 108,755,205 M116I probably damaging Het
Olfr593 C T 7: 103,212,664 A268V possibly damaging Het
Per2 T C 1: 91,423,767 T1006A probably benign Het
Phyhd1 C A 2: 30,266,905 F19L probably benign Het
Pter T A 2: 12,980,301 D147E probably benign Het
Rps6ka1 A C 4: 133,871,589 L90V probably damaging Het
Rrp15 A T 1: 186,749,171 D46E probably benign Het
Ryr2 A G 13: 11,794,573 F789L probably damaging Het
Sepsecs T C 5: 52,643,952 K456R probably benign Het
Sept11 G A 5: 93,173,538 probably null Het
Sowahb T C 5: 93,043,221 I546M possibly damaging Het
Spata31 C A 13: 64,922,522 T828K probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Ston1 A G 17: 88,635,606 T147A probably benign Het
Tcf3 G A 10: 80,416,602 P350S probably benign Het
Tek A G 4: 94,827,278 D402G probably benign Het
Themis3 T C 17: 66,559,670 R192G probably damaging Het
Trpc3 T G 3: 36,651,628 I473L probably benign Het
Ttll2 A T 17: 7,352,686 L4Q probably damaging Het
Urb2 T A 8: 124,023,487 Y5* probably null Het
Vav3 T A 3: 109,657,245 Y673* probably null Het
Vmn1r32 T A 6: 66,553,253 T180S probably benign Het
Vmn1r90 A T 7: 14,561,722 N150K probably damaging Het
Zfp72 A G 13: 74,372,584 I125T probably damaging Het
Zfp750 G A 11: 121,513,867 R61C probably damaging Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20816192 missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20832454 missense probably benign 0.00
IGL02245:Tmc1 APN 19 20799192 missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20906963 missense probably benign 0.04
IGL02699:Tmc1 APN 19 20832350 critical splice donor site probably null
IGL02974:Tmc1 APN 19 20900844 missense probably benign
IGL03194:Tmc1 APN 19 20804653 missense probably damaging 1.00
dinner_bell UTSW 19 20795516 missense probably damaging 0.99
R0255:Tmc1 UTSW 19 20789587 missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20799045 missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20799176 missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20816184 missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20868355 missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20816122 missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20826501 splice site probably null
R1777:Tmc1 UTSW 19 20816109 critical splice donor site probably null
R2067:Tmc1 UTSW 19 20824309 missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20856675 missense probably benign 0.01
R2180:Tmc1 UTSW 19 20824084 missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2205:Tmc1 UTSW 19 20940905 missense probably benign 0.01
R2285:Tmc1 UTSW 19 20789799 missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20868374 missense probably benign 0.00
R4752:Tmc1 UTSW 19 20826649 missense probably benign 0.35
R4975:Tmc1 UTSW 19 20906955 missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20824030 missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20826660 missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20804602 missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20789622 missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20789590 missense possibly damaging 0.53
R6784:Tmc1 UTSW 19 20827651 critical splice donor site probably null
R6796:Tmc1 UTSW 19 20799036 missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20795516 missense probably damaging 0.99
R6812:Tmc1 UTSW 19 20900861 missense probably damaging 1.00
R6834:Tmc1 UTSW 19 20795610 nonsense probably null
R6978:Tmc1 UTSW 19 20804635 missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20824283 missense probably benign 0.02
R7027:Tmc1 UTSW 19 20940903 critical splice donor site probably null
R7378:Tmc1 UTSW 19 20868389 missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20799178 missense probably damaging 0.99
R7573:Tmc1 UTSW 19 20907008 missense probably damaging 0.98
R7825:Tmc1 UTSW 19 20804645 missense possibly damaging 0.55
R8024:Tmc1 UTSW 19 20900817 missense probably damaging 1.00
R8073:Tmc1 UTSW 19 20868361 missense probably benign 0.08
R8786:Tmc1 UTSW 19 20826589 missense probably damaging 1.00
R8791:Tmc1 UTSW 19 20789845 missense probably benign 0.00
R8969:Tmc1 UTSW 19 20816229 missense probably damaging 1.00
R8973:Tmc1 UTSW 19 20900851 missense probably benign
R9493:Tmc1 UTSW 19 20824280 missense probably benign 0.00
Z1176:Tmc1 UTSW 19 20826506 missense probably null 1.00
Z1177:Tmc1 UTSW 19 20795608 missense possibly damaging 0.47
Z1177:Tmc1 UTSW 19 20823982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACTCGTGTAACTCGGAG -3'
(R):5'- TGGAGACAGTTTGAGAGTAACC -3'

Sequencing Primer
(F):5'- TGTAACTCGGAGGCATCCTAC -3'
(R):5'- AGACAGTTTGAGAGTAACCAAATAC -3'
Posted On 2022-05-16