Mutagenetix > Incidental Mutation

Incidental Mutation 'R9430:Trpm1'

712880

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9430 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64223698 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 567 (L567P)

Ref Sequence

ENSEMBL: ENSMUSP00000082318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

probably benign
Transcript: ENSMUST00000085222
AA Change: L567P

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: L567P

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000177102
AA Change: L451P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: L451P

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000205348

Predicted Effect

probably benign
Transcript: ENSMUST00000205731

Predicted Effect

probably benign
Transcript: ENSMUST00000205994
AA Change: L75P

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

Predicted Effect

probably benign
Transcript: ENSMUST00000206263
AA Change: L451P

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206277
AA Change: L567P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

probably benign
Transcript: ENSMUST00000206706

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	A	T	10: 116,113,377	D81E	probably damaging	Het
Als2	A	C	1: 59,192,039	N804K	probably benign	Het
Arid5b	C	A	10: 68,186,257		probably null	Het
Brd2	T	C	17: 34,112,636	D779G	unknown	Het
Brox	A	T	1: 183,287,789	V118E	probably damaging	Het
Ccdc137	A	T	11: 120,458,704	E76V	probably damaging	Het
Ccdc150	A	G	1: 54,281,771	K327E	probably damaging	Het
Ccdc171	A	G	4: 83,604,125	E342G	probably damaging	Het
Cd109	G	A	9: 78,667,416		probably null	Het
Cep85	C	A	4: 134,167,354	R47L	probably damaging	Het
Cgrrf1	T	A	14: 46,853,874	V285E	probably damaging	Het
Ctu1	T	C	7: 43,676,618	S234P	probably damaging	Het
Dnah3	G	A	7: 120,028,982	T1484I	probably damaging	Het
Dusp16	G	T	6: 134,760,866	Q70K	probably damaging	Het
Eri3	T	G	4: 117,582,671	Y187*	probably null	Het
Evi2a	T	A	11: 79,527,697	Y29F	possibly damaging	Het
Ext2	A	G	2: 93,762,654	S402P	possibly damaging	Het
Fam76a	T	A	4: 132,917,744	Q60L	probably damaging	Het
Fat3	T	C	9: 16,376,085	N714S	probably damaging	Het
Fbxw24	T	A	9: 109,609,970	N179I	probably damaging	Het
Fras1	A	G	5: 96,781,392	N3885S	probably benign	Het
Grip2	A	T	6: 91,807,284	V12E	probably benign	Het
Gse1	A	T	8: 120,572,310	Y766F	unknown	Het
Herc1	C	T	9: 66,418,503	Q1420*	probably null	Het
Htr1f	T	A	16: 64,926,468	I154F	probably damaging	Het
Hus1b	G	T	13: 30,947,604	A24E	probably damaging	Het
Igkv17-127	A	G	6: 67,861,457	I51V	probably damaging	Het
Ilk	G	T	7: 105,740,865	R149L	probably benign	Het
Inpp5b	T	A	4: 124,742,547	V5E	possibly damaging	Het
Jak2	A	T	19: 29,287,967	S465C	possibly damaging	Het
Kif23	T	C	9: 61,927,440	T394A	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lama4	A	G	10: 39,045,806	D441G	probably null	Het
Ldhd	A	G	8: 111,630,048	L27P	possibly damaging	Het
Lingo1	A	G	9: 56,620,228	I365T	probably benign	Het
Lyz2	C	A	10: 117,282,172	C24F	possibly damaging	Het
Map1b	T	A	13: 99,434,108	T702S	unknown	Het
Map4	T	A	9: 110,034,692	D328E	probably benign	Het
Matn1	C	T	4: 130,945,967	T82M	probably damaging	Het
Mfrp	T	C	9: 44,103,273	V239A	probably damaging	Het
Misp	G	T	10: 79,825,841	V31F	probably benign	Het
Muc5ac	C	T	7: 141,808,832	T1960I	unknown	Het
Myh2	T	A	11: 67,179,533	M434K	probably benign	Het
Myh3	T	A	11: 67,091,900	I815N	possibly damaging	Het
Myo18a	A	G	11: 77,818,584	M507V	possibly damaging	Het
Nbas	T	A	12: 13,321,653	S385T	probably benign	Het
Nepro	G	A	16: 44,732,097	R319K	possibly damaging	Het
Nlrc3	A	T	16: 3,965,532	C53S	probably benign	Het
Nudt17	A	G	3: 96,706,908		probably null	Het
Nwd2	T	G	5: 63,807,322	C1416W	probably damaging	Het
Ocln	A	C	13: 100,539,848	F46V	possibly damaging	Het
Olfr1105	A	T	2: 87,033,909	V104D	probably damaging	Het
Olfr665	A	T	7: 104,880,997	N97Y	possibly damaging	Het
Osbpl5	T	C	7: 143,709,789	K119R	probably benign	Het
Paf1	T	G	7: 28,396,906	F315V	possibly damaging	Het
Parp4	T	A	14: 56,629,216	V1079D	probably damaging	Het
Pcgf6	C	T	19: 47,050,780	A14T	unknown	Het
Plcxd1	A	G	5: 110,103,502	T315A	probably benign	Het
Plxnc1	A	G	10: 94,922,682	V384A	probably benign	Het
Polm	G	A	11: 5,834,749	T236I	probably damaging	Het
Prl7d1	T	C	13: 27,714,377	T50A	possibly damaging	Het
Reln	T	C	5: 21,915,107	D2849G	probably damaging	Het
Sec16b	C	T	1: 157,567,324	R1045C	probably damaging	Het
Six4	A	G	12: 73,103,945	S609P	possibly damaging	Het
Slc25a31	A	T	3: 40,724,866		probably null	Het
Slc4a2	A	G	5: 24,431,319	N230S	probably benign	Het
Sorcs1	T	C	19: 50,210,770	Y785C	probably damaging	Het
Styxl1	A	G	5: 135,755,405		probably null	Het
Synm	C	T	7: 67,733,433	V1494M	possibly damaging	Het
Tamm41	A	G	6: 115,016,102	M230T	probably benign	Het
Tbc1d12	T	G	19: 38,896,046	M347R	probably damaging	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tm4sf1	A	C	3: 57,289,793	S164A	probably damaging	Het
Trim67	A	G	8: 124,826,217	H686R	probably damaging	Het
Tsfm	A	G	10: 127,022,902	L198P	probably damaging	Het
Ttc6	A	T	12: 57,686,407	D1112V	probably damaging	Het
Ttn	A	G	2: 76,771,578	V18580A	probably benign	Het
Ubr1	C	A	2: 120,904,025	Q1131H	possibly damaging	Het
Uhrf2	C	T	19: 30,039,259	R117C	probably benign	Het
Vmn2r70	A	G	7: 85,566,032	V98A	probably benign	Het
Zfp799	T	C	17: 32,820,212	E360G	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACTGATCACTCTATCTGGCCAC -3'
(R):5'- ACCACATGTTACTCTGGGAGG -3'

Sequencing Primer
(F):5'- CACAGGTGTGCCATGGACTCTATAG -3'
(R):5'- CATGTTACTCTGGGAGGCACAG -3'

Posted On

2022-05-16