Incidental Mutation 'R9430:Map1b'
ID 712918
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, MAP5, Mtap-5, Mtap5, LC1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9430 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 99421446-99516540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 99434108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 702 (T702S)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: T702S
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: T702S

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A T 10: 116,113,377 D81E probably damaging Het
Als2 A C 1: 59,192,039 N804K probably benign Het
Arid5b C A 10: 68,186,257 probably null Het
Brd2 T C 17: 34,112,636 D779G unknown Het
Brox A T 1: 183,287,789 V118E probably damaging Het
Ccdc137 A T 11: 120,458,704 E76V probably damaging Het
Ccdc150 A G 1: 54,281,771 K327E probably damaging Het
Ccdc171 A G 4: 83,604,125 E342G probably damaging Het
Cd109 G A 9: 78,667,416 probably null Het
Cep85 C A 4: 134,167,354 R47L probably damaging Het
Cgrrf1 T A 14: 46,853,874 V285E probably damaging Het
Ctu1 T C 7: 43,676,618 S234P probably damaging Het
Dnah3 G A 7: 120,028,982 T1484I probably damaging Het
Dusp16 G T 6: 134,760,866 Q70K probably damaging Het
Eri3 T G 4: 117,582,671 Y187* probably null Het
Evi2a T A 11: 79,527,697 Y29F possibly damaging Het
Ext2 A G 2: 93,762,654 S402P possibly damaging Het
Fam76a T A 4: 132,917,744 Q60L probably damaging Het
Fat3 T C 9: 16,376,085 N714S probably damaging Het
Fbxw24 T A 9: 109,609,970 N179I probably damaging Het
Fras1 A G 5: 96,781,392 N3885S probably benign Het
Grip2 A T 6: 91,807,284 V12E probably benign Het
Gse1 A T 8: 120,572,310 Y766F unknown Het
Herc1 C T 9: 66,418,503 Q1420* probably null Het
Htr1f T A 16: 64,926,468 I154F probably damaging Het
Hus1b G T 13: 30,947,604 A24E probably damaging Het
Igkv17-127 A G 6: 67,861,457 I51V probably damaging Het
Ilk G T 7: 105,740,865 R149L probably benign Het
Inpp5b T A 4: 124,742,547 V5E possibly damaging Het
Jak2 A T 19: 29,287,967 S465C possibly damaging Het
Kif23 T C 9: 61,927,440 T394A probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,045,806 D441G probably null Het
Ldhd A G 8: 111,630,048 L27P possibly damaging Het
Lingo1 A G 9: 56,620,228 I365T probably benign Het
Lyz2 C A 10: 117,282,172 C24F possibly damaging Het
Map4 T A 9: 110,034,692 D328E probably benign Het
Matn1 C T 4: 130,945,967 T82M probably damaging Het
Mfrp T C 9: 44,103,273 V239A probably damaging Het
Misp G T 10: 79,825,841 V31F probably benign Het
Muc5ac C T 7: 141,808,832 T1960I unknown Het
Myh2 T A 11: 67,179,533 M434K probably benign Het
Myh3 T A 11: 67,091,900 I815N possibly damaging Het
Myo18a A G 11: 77,818,584 M507V possibly damaging Het
Nbas T A 12: 13,321,653 S385T probably benign Het
Nepro G A 16: 44,732,097 R319K possibly damaging Het
Nlrc3 A T 16: 3,965,532 C53S probably benign Het
Nudt17 A G 3: 96,706,908 probably null Het
Nwd2 T G 5: 63,807,322 C1416W probably damaging Het
Ocln A C 13: 100,539,848 F46V possibly damaging Het
Olfr1105 A T 2: 87,033,909 V104D probably damaging Het
Olfr665 A T 7: 104,880,997 N97Y possibly damaging Het
Osbpl5 T C 7: 143,709,789 K119R probably benign Het
Paf1 T G 7: 28,396,906 F315V possibly damaging Het
Parp4 T A 14: 56,629,216 V1079D probably damaging Het
Pcgf6 C T 19: 47,050,780 A14T unknown Het
Plcxd1 A G 5: 110,103,502 T315A probably benign Het
Plxnc1 A G 10: 94,922,682 V384A probably benign Het
Polm G A 11: 5,834,749 T236I probably damaging Het
Prl7d1 T C 13: 27,714,377 T50A possibly damaging Het
Reln T C 5: 21,915,107 D2849G probably damaging Het
Sec16b C T 1: 157,567,324 R1045C probably damaging Het
Six4 A G 12: 73,103,945 S609P possibly damaging Het
Slc25a31 A T 3: 40,724,866 probably null Het
Slc4a2 A G 5: 24,431,319 N230S probably benign Het
Sorcs1 T C 19: 50,210,770 Y785C probably damaging Het
Styxl1 A G 5: 135,755,405 probably null Het
Synm C T 7: 67,733,433 V1494M possibly damaging Het
Tamm41 A G 6: 115,016,102 M230T probably benign Het
Tbc1d12 T G 19: 38,896,046 M347R probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tm4sf1 A C 3: 57,289,793 S164A probably damaging Het
Trim67 A G 8: 124,826,217 H686R probably damaging Het
Trpm1 T C 7: 64,223,698 L567P probably benign Het
Tsfm A G 10: 127,022,902 L198P probably damaging Het
Ttc6 A T 12: 57,686,407 D1112V probably damaging Het
Ttn A G 2: 76,771,578 V18580A probably benign Het
Ubr1 C A 2: 120,904,025 Q1131H possibly damaging Het
Uhrf2 C T 19: 30,039,259 R117C probably benign Het
Vmn2r70 A G 7: 85,566,032 V98A probably benign Het
Zfp799 T C 17: 32,820,212 E360G probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
R7349:Map1b UTSW 13 99433640 missense unknown
R7448:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7449:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7452:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7810:Map1b UTSW 13 99431882 missense unknown
R7820:Map1b UTSW 13 99431177 missense unknown
R8396:Map1b UTSW 13 99434113 missense unknown
R8470:Map1b UTSW 13 99516442 missense probably damaging 0.98
R8535:Map1b UTSW 13 99435154 missense probably damaging 1.00
R8777:Map1b UTSW 13 99430796 missense unknown
R8777-TAIL:Map1b UTSW 13 99430796 missense unknown
R8812:Map1b UTSW 13 99432815 missense unknown
R8903:Map1b UTSW 13 99432509 nonsense probably null
R8928:Map1b UTSW 13 99432116 missense unknown
R8954:Map1b UTSW 13 99434227 missense unknown
R9164:Map1b UTSW 13 99425843 missense unknown
R9164:Map1b UTSW 13 99432308 nonsense probably null
R9190:Map1b UTSW 13 99435406 missense probably damaging 0.99
R9334:Map1b UTSW 13 99431640 missense unknown
R9339:Map1b UTSW 13 99431062 missense unknown
R9357:Map1b UTSW 13 99430200 nonsense probably null
RF003:Map1b UTSW 13 99430750 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GAGGCTCCTTCTTAGTGGACTC -3'
(R):5'- CTGAGAAGCAAGCCACTGAG -3'

Sequencing Primer
(F):5'- AGTGGACTCTTCTTTCTTCGCTAC -3'
(R):5'- CCAAAGTCACCAAGGACAAAGTGG -3'
Posted On 2022-05-16