Incidental Mutation 'R9430:Htr1f'
ID 712925
Institutional Source Beutler Lab
Gene Symbol Htr1f
Ensembl Gene ENSMUSG00000050783
Gene Name 5-hydroxytryptamine (serotonin) receptor 1F
Synonyms Htr1eb
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9430 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 64924729-65105854 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64926468 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 154 (I154F)
Ref Sequence ENSEMBL: ENSMUSP00000063136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063076]
AlphaFold Q02284
Predicted Effect probably damaging
Transcript: ENSMUST00000063076
AA Change: I154F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063136
Gene: ENSMUSG00000050783
AA Change: I154F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 32 230 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 34 362 2.4e-10 PFAM
Pfam:7tm_1 40 347 4.1e-74 PFAM
Pfam:7TM_GPCR_Srv 54 249 5.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display decreased temperature sensitivity and physiological abnormalities in nerve fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A T 10: 116,113,377 D81E probably damaging Het
Als2 A C 1: 59,192,039 N804K probably benign Het
Arid5b C A 10: 68,186,257 probably null Het
Brd2 T C 17: 34,112,636 D779G unknown Het
Brox A T 1: 183,287,789 V118E probably damaging Het
Ccdc137 A T 11: 120,458,704 E76V probably damaging Het
Ccdc150 A G 1: 54,281,771 K327E probably damaging Het
Ccdc171 A G 4: 83,604,125 E342G probably damaging Het
Cd109 G A 9: 78,667,416 probably null Het
Cep85 C A 4: 134,167,354 R47L probably damaging Het
Cgrrf1 T A 14: 46,853,874 V285E probably damaging Het
Ctu1 T C 7: 43,676,618 S234P probably damaging Het
Dnah3 G A 7: 120,028,982 T1484I probably damaging Het
Dusp16 G T 6: 134,760,866 Q70K probably damaging Het
Eri3 T G 4: 117,582,671 Y187* probably null Het
Evi2a T A 11: 79,527,697 Y29F possibly damaging Het
Ext2 A G 2: 93,762,654 S402P possibly damaging Het
Fam76a T A 4: 132,917,744 Q60L probably damaging Het
Fat3 T C 9: 16,376,085 N714S probably damaging Het
Fbxw24 T A 9: 109,609,970 N179I probably damaging Het
Fras1 A G 5: 96,781,392 N3885S probably benign Het
Grip2 A T 6: 91,807,284 V12E probably benign Het
Gse1 A T 8: 120,572,310 Y766F unknown Het
Herc1 C T 9: 66,418,503 Q1420* probably null Het
Hus1b G T 13: 30,947,604 A24E probably damaging Het
Igkv17-127 A G 6: 67,861,457 I51V probably damaging Het
Ilk G T 7: 105,740,865 R149L probably benign Het
Inpp5b T A 4: 124,742,547 V5E possibly damaging Het
Jak2 A T 19: 29,287,967 S465C possibly damaging Het
Kif23 T C 9: 61,927,440 T394A probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,045,806 D441G probably null Het
Ldhd A G 8: 111,630,048 L27P possibly damaging Het
Lingo1 A G 9: 56,620,228 I365T probably benign Het
Lyz2 C A 10: 117,282,172 C24F possibly damaging Het
Map1b T A 13: 99,434,108 T702S unknown Het
Map4 T A 9: 110,034,692 D328E probably benign Het
Matn1 C T 4: 130,945,967 T82M probably damaging Het
Mfrp T C 9: 44,103,273 V239A probably damaging Het
Misp G T 10: 79,825,841 V31F probably benign Het
Muc5ac C T 7: 141,808,832 T1960I unknown Het
Myh2 T A 11: 67,179,533 M434K probably benign Het
Myh3 T A 11: 67,091,900 I815N possibly damaging Het
Myo18a A G 11: 77,818,584 M507V possibly damaging Het
Nbas T A 12: 13,321,653 S385T probably benign Het
Nepro G A 16: 44,732,097 R319K possibly damaging Het
Nlrc3 A T 16: 3,965,532 C53S probably benign Het
Nudt17 A G 3: 96,706,908 probably null Het
Nwd2 T G 5: 63,807,322 C1416W probably damaging Het
Ocln A C 13: 100,539,848 F46V possibly damaging Het
Olfr1105 A T 2: 87,033,909 V104D probably damaging Het
Olfr665 A T 7: 104,880,997 N97Y possibly damaging Het
Osbpl5 T C 7: 143,709,789 K119R probably benign Het
Paf1 T G 7: 28,396,906 F315V possibly damaging Het
Parp4 T A 14: 56,629,216 V1079D probably damaging Het
Pcgf6 C T 19: 47,050,780 A14T unknown Het
Plcxd1 A G 5: 110,103,502 T315A probably benign Het
Plxnc1 A G 10: 94,922,682 V384A probably benign Het
Polm G A 11: 5,834,749 T236I probably damaging Het
Prl7d1 T C 13: 27,714,377 T50A possibly damaging Het
Reln T C 5: 21,915,107 D2849G probably damaging Het
Sec16b C T 1: 157,567,324 R1045C probably damaging Het
Six4 A G 12: 73,103,945 S609P possibly damaging Het
Slc25a31 A T 3: 40,724,866 probably null Het
Slc4a2 A G 5: 24,431,319 N230S probably benign Het
Sorcs1 T C 19: 50,210,770 Y785C probably damaging Het
Styxl1 A G 5: 135,755,405 probably null Het
Synm C T 7: 67,733,433 V1494M possibly damaging Het
Tamm41 A G 6: 115,016,102 M230T probably benign Het
Tbc1d12 T G 19: 38,896,046 M347R probably damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tm4sf1 A C 3: 57,289,793 S164A probably damaging Het
Trim67 A G 8: 124,826,217 H686R probably damaging Het
Trpm1 T C 7: 64,223,698 L567P probably benign Het
Tsfm A G 10: 127,022,902 L198P probably damaging Het
Ttc6 A T 12: 57,686,407 D1112V probably damaging Het
Ttn A G 2: 76,771,578 V18580A probably benign Het
Ubr1 C A 2: 120,904,025 Q1131H possibly damaging Het
Uhrf2 C T 19: 30,039,259 R117C probably benign Het
Vmn2r70 A G 7: 85,566,032 V98A probably benign Het
Zfp799 T C 17: 32,820,212 E360G probably damaging Het
Other mutations in Htr1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Htr1f APN 16 64926106 missense probably benign 0.00
IGL01134:Htr1f APN 16 64926138 missense probably benign 0.00
IGL01455:Htr1f APN 16 64926022 missense probably damaging 1.00
IGL01580:Htr1f APN 16 64925835 nonsense probably null
IGL01865:Htr1f APN 16 64925919 missense probably damaging 1.00
IGL02027:Htr1f APN 16 64926321 nonsense probably null
IGL02234:Htr1f APN 16 64926067 missense probably damaging 1.00
IGL02567:Htr1f APN 16 64926248 missense probably benign 0.45
R0035:Htr1f UTSW 16 64926497 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0132:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0193:Htr1f UTSW 16 64926749 missense probably damaging 1.00
R0523:Htr1f UTSW 16 64925899 missense probably damaging 1.00
R0722:Htr1f UTSW 16 64925891 missense probably damaging 0.99
R2055:Htr1f UTSW 16 64926035 missense probably damaging 1.00
R3418:Htr1f UTSW 16 64925897 missense probably damaging 1.00
R4090:Htr1f UTSW 16 64925961 missense probably benign 0.06
R4320:Htr1f UTSW 16 64926687 missense possibly damaging 0.87
R5037:Htr1f UTSW 16 64925928 missense probably damaging 1.00
R6004:Htr1f UTSW 16 64925876 missense probably damaging 1.00
R7383:Htr1f UTSW 16 64926843 missense probably benign 0.00
R7462:Htr1f UTSW 16 64926020 missense probably damaging 0.99
R7864:Htr1f UTSW 16 64926794 missense probably damaging 1.00
R8677:Htr1f UTSW 16 64926051 missense possibly damaging 0.69
R8816:Htr1f UTSW 16 64926174 missense probably benign 0.05
R8836:Htr1f UTSW 16 64926833 missense probably benign
R9106:Htr1f UTSW 16 64926274 missense probably damaging 1.00
R9155:Htr1f UTSW 16 64926425 missense probably benign 0.00
R9182:Htr1f UTSW 16 64926462 missense probably benign 0.03
R9244:Htr1f UTSW 16 64926494 missense probably benign 0.31
Z1176:Htr1f UTSW 16 64926077 nonsense probably null
Z1176:Htr1f UTSW 16 64926874 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGACTTGACCGTTCAGCTC -3'
(R):5'- ACATTTGGCTGAGTGTCGAC -3'

Sequencing Primer
(F):5'- ACTCGCTTGTCTCTTGTGGTACAG -3'
(R):5'- GGCTGAGTGTCGACATCATC -3'
Posted On 2022-05-16