Incidental Mutation 'R9432:Csmd2'
ID 712997
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock # R9432 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 127987857-128567656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 128277211 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 332 (H332Q)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
AlphaFold no structure available at present
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,737,051 R314G unknown Het
Abca13 G A 11: 9,294,559 V2141M probably benign Het
Abcc10 G A 17: 46,323,784 A431V possibly damaging Het
Acod1 A G 14: 103,054,978 R313G probably damaging Het
Adam3 G T 8: 24,703,912 S361R probably damaging Het
Ahcyl2 C T 6: 29,768,875 T113M possibly damaging Het
Ano8 C A 8: 71,480,917 R577L unknown Het
Arhgef7 T A 8: 11,819,646 S653R probably damaging Het
Atp10a G A 7: 58,819,670 V1090I possibly damaging Het
Birc6 A G 17: 74,659,221 M4048V probably benign Het
C3 G A 17: 57,223,950 P384S probably damaging Het
Camkk1 A T 11: 73,037,931 E432V probably damaging Het
Celsr3 T A 9: 108,848,833 V3087D probably benign Het
Ckap4 A G 10: 84,527,679 S507P probably damaging Het
Coq6 G A 12: 84,373,690 M471I probably benign Het
Cxcr1 T A 1: 74,192,072 N264Y probably damaging Het
Dchs2 C A 3: 83,128,725 R260S possibly damaging Het
Elmod2 C A 8: 83,331,132 A41S possibly damaging Het
Emilin2 G A 17: 71,274,786 T315I probably benign Het
Eml1 A G 12: 108,516,583 N487S probably benign Het
Epn1 G T 7: 5,093,370 R221L probably benign Het
Faah A G 4: 116,017,575 V28A probably benign Het
Fbl G A 7: 28,177,264 R230H probably benign Het
Fsip2 C T 2: 82,975,563 S742F probably damaging Het
Gm5460 A G 14: 34,045,812 D184G possibly damaging Het
Gpatch2l T C 12: 86,260,634 V262A probably damaging Het
Grin2c A T 11: 115,251,226 L789* probably null Het
H1f0 C T 15: 79,028,747 P9L probably damaging Het
Hectd4 A G 5: 121,322,801 T948A probably benign Het
Herc2 G A 7: 56,131,184 G1199D probably damaging Het
Hoxb7 G T 11: 96,286,791 A22S possibly damaging Het
Ifih1 T A 2: 62,609,274 I519F probably damaging Het
Ifit1bl1 T A 19: 34,594,098 I320F possibly damaging Het
Iqgap2 T C 13: 95,637,753 T1320A probably benign Het
Kat2a A G 11: 100,711,352 V192A probably damaging Het
Kat6b A C 14: 21,622,009 H329P probably damaging Het
Klhl29 A G 12: 5,210,056 L54P probably benign Het
Kntc1 A T 5: 123,787,049 I1142F possibly damaging Het
Lipo3 A G 19: 33,556,464 Y323H probably damaging Het
Lmtk3 G A 7: 45,792,570 V351I probably damaging Het
Lrrc8b T C 5: 105,486,022 S787P probably benign Het
Magi1 A G 6: 93,683,077 I1179T probably damaging Het
Mapk11 T C 15: 89,144,428 D269G probably benign Het
Mfsd13a T G 19: 46,366,429 I15R probably benign Het
Myo1h G A 5: 114,361,305 V143I possibly damaging Het
Naaladl1 T C 19: 6,106,887 I187T possibly damaging Het
Nos1 G A 5: 117,896,806 V416M probably damaging Het
Olfr1076 T G 2: 86,508,570 I37S probably benign Het
Olfr294 G A 7: 86,615,857 R263C possibly damaging Het
Olfr761 A G 17: 37,952,668 S119P probably damaging Het
Pcdh15 A G 10: 74,624,338 T1373A probably damaging Het
Pcdh18 T G 3: 49,745,218 M932L probably damaging Het
Pcdhb15 T A 18: 37,475,630 H638Q probably benign Het
Pcdhb19 A G 18: 37,497,575 E141G possibly damaging Het
Pds5b T G 5: 150,769,791 L656R probably damaging Het
Plcl1 T C 1: 55,406,428 L14P probably benign Het
Pzp A T 6: 128,522,165 I173N Het
Rnf123 C T 9: 108,059,809 R849H probably damaging Het
Sfrp5 T C 19: 42,199,786 D198G probably damaging Het
Sftpb G C 6: 72,306,859 A147P probably benign Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Slc30a6 A G 17: 74,412,704 T220A possibly damaging Het
Slc5a3 T A 16: 92,077,727 V224D probably benign Het
Smad5 T A 13: 56,727,604 Y202N probably benign Het
Smok2b A G 17: 13,234,994 I14V probably damaging Het
Tas2r108 T A 6: 40,494,187 I199K probably damaging Het
Tcea2 A G 2: 181,680,434 I10V probably damaging Het
Tfg G A 16: 56,704,505 R113* probably null Het
Tubb4a A T 17: 57,081,034 L331I probably benign Het
Ugt2b37 A G 5: 87,254,187 V195A probably damaging Het
Umad1 A G 6: 8,401,096 H55R unknown Het
Vmn1r176 A T 7: 23,835,318 Y137N probably damaging Het
Vmn1r44 T A 6: 89,893,491 M73K possibly damaging Het
Vmn2r112 A G 17: 22,602,252 T69A Het
Vmn2r59 A T 7: 42,046,830 Y163N probably damaging Het
Vps13c T A 9: 67,922,855 D1514E probably benign Het
Vsir A G 10: 60,357,953 D65G possibly damaging Het
Ypel3 A T 7: 126,780,090 M112L probably benign Het
Zfp26 T A 9: 20,436,534 K911N probably damaging Het
Zfp362 C T 4: 128,777,187 R346Q probably damaging Het
Zfp595 A T 13: 67,317,343 Y288* probably null Het
Zfyve28 G T 5: 34,243,289 Q22K possibly damaging Het
Zswim4 T G 8: 84,236,910 D32A probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 splice site probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 splice site probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
R8504:Csmd2 UTSW 4 128546690 missense
R8511:Csmd2 UTSW 4 128368899 missense
R8517:Csmd2 UTSW 4 128552686 missense
R8704:Csmd2 UTSW 4 128197354 missense
R8722:Csmd2 UTSW 4 128551950 unclassified probably benign
R8729:Csmd2 UTSW 4 128462845 missense
R8801:Csmd2 UTSW 4 128563402 missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128546684 missense
R8839:Csmd2 UTSW 4 128442888 missense
R8867:Csmd2 UTSW 4 128557676 missense
R8913:Csmd2 UTSW 4 128523558 missense
R8928:Csmd2 UTSW 4 128475789 missense
R8974:Csmd2 UTSW 4 128552587 missense
R9001:Csmd2 UTSW 4 128414286 missense
R9132:Csmd2 UTSW 4 128549214 missense
R9245:Csmd2 UTSW 4 128306375 missense
R9249:Csmd2 UTSW 4 128419530 nonsense probably null
R9254:Csmd2 UTSW 4 128197319 missense
R9265:Csmd2 UTSW 4 128400370 missense
R9407:Csmd2 UTSW 4 128548820 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- GGCCTCCTAGAGCATCAGATAG -3'
(R):5'- TGCCCCTCTGGTACCTAAAG -3'

Sequencing Primer
(F):5'- ATCAGATAGATGGTGCTCTCCTC -3'
(R):5'- CCTAGGCATGTGCAGAGATGC -3'
Posted On 2022-05-16