Incidental Mutation 'R9433:Fcho1'
ID 713104
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R9433 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71708387-71725716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71716824 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 146 (M146K)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000125092] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
AlphaFold Q8K285
Predicted Effect probably benign
Transcript: ENSMUST00000093444
AA Change: M146K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: M146K

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125092
SMART Domains Protein: ENSMUSP00000123554
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 88 7.62e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136640
AA Change: M146K

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000
AA Change: M146K

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146100
AA Change: M146K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: M146K

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153800
AA Change: M146K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000
AA Change: M146K

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T C 12: 81,419,949 T633A possibly damaging Het
Adgrv1 A T 13: 81,566,352 F937L probably benign Het
Adipor2 A T 6: 119,359,525 F159Y probably damaging Het
Ahcyl1 A G 3: 107,668,329 V380A probably damaging Het
Akp3 A G 1: 87,125,795 K157E probably benign Het
Arpc1a T A 5: 145,108,393 I364N possibly damaging Het
Bach1 C G 16: 87,719,715 S381R probably benign Het
Brms1l G A 12: 55,866,078 probably null Het
Camk1d A G 2: 5,675,966 S6P unknown Het
Ccdc112 C A 18: 46,290,973 V233L probably benign Het
Ccdc113 A T 8: 95,545,985 N240I possibly damaging Het
Ccdc6 T C 10: 70,169,121 V232A possibly damaging Het
Cct5 A G 15: 31,592,737 I409T possibly damaging Het
Cd96 A G 16: 46,035,935 Y583H probably damaging Het
Cdh22 C T 2: 165,112,409 V731M probably benign Het
Clcn1 C T 6: 42,305,560 P521S probably damaging Het
Clec18a C T 8: 111,081,690 A27T probably benign Het
Cnnm2 C T 19: 46,762,368 A199V probably benign Het
Copg1 G A 6: 87,903,496 A494T possibly damaging Het
Cpsf2 A G 12: 101,981,993 E16G probably damaging Het
Cyp2j5 T A 4: 96,664,007 I2F probably benign Het
Dgkg T A 16: 22,565,315 N463Y probably damaging Het
Dnah11 T C 12: 118,012,272 D2804G probably damaging Het
Efcab12 T C 6: 115,816,034 N488D probably benign Het
Etv5 G A 16: 22,435,918 P64L probably damaging Het
Fbrs A G 7: 127,485,100 E468G probably benign Het
Gad1 A T 2: 70,593,463 M405L Het
Gcc2 T A 10: 58,270,770 H609Q probably benign Het
Gm11983 A T 11: 6,836,902 M75K unknown Het
Gm4353 T A 7: 116,083,636 I237F probably damaging Het
Gm8251 A T 1: 44,056,508 V1810E possibly damaging Het
H1f0 C T 15: 79,028,747 P9L probably damaging Het
Hcn4 A G 9: 58,823,939 D143G unknown Het
Id1 T A 2: 152,736,510 V57D probably damaging Het
Ifna13 T C 4: 88,644,303 Q28R probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Lonrf2 G A 1: 38,836,457 probably benign Het
Magi3 C T 3: 104,015,157 A1415T probably benign Het
Mia2 A G 12: 59,101,585 E77G probably damaging Het
Muc16 T A 9: 18,572,641 Q6945L probably benign Het
Nos2 G A 11: 78,959,664 R1116H probably damaging Het
Olfr1362 C T 13: 21,611,054 C305Y probably benign Het
Parpbp A C 10: 88,139,996 V85G probably benign Het
Pcmtd2 C T 2: 181,855,044 H273Y possibly damaging Het
Pcp4l1 C T 1: 171,174,429 G54D probably damaging Het
Pkdrej T C 15: 85,819,869 H622R probably benign Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Pnpla8 T C 12: 44,283,522 S286P probably damaging Het
Prss36 C T 7: 127,934,167 V631I probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Ranbp9 A T 13: 43,422,565 I222N probably damaging Het
Rev1 T C 1: 38,053,092 T1249A probably damaging Het
Ripply2 G T 9: 87,019,662 W80C probably damaging Het
Rnaseh2b C A 14: 62,365,273 P235Q probably benign Het
Sacs T A 14: 61,206,548 F2014L probably damaging Het
Serpinb9f A G 13: 33,334,255 N246S probably benign Het
Sh3pxd2a A T 19: 47,267,100 S1088T probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skint3 A G 4: 112,280,235 I367V probably benign Het
Slc20a2 G T 8: 22,561,195 E415* probably null Het
Slc5a1 T A 5: 33,152,681 S418T probably benign Het
Spats2 G T 15: 99,178,565 G175* probably null Het
Srebf1 A T 11: 60,204,189 F485L possibly damaging Het
St8sia4 A G 1: 95,627,639 V222A Het
Stab1 C T 14: 31,143,574 E1786K probably benign Het
Stat2 A G 10: 128,276,788 M58V probably benign Het
Stat5a A G 11: 100,875,044 T319A probably benign Het
Sufu A G 19: 46,397,093 probably benign Het
Tle6 T A 10: 81,591,046 I579F probably damaging Het
Tmem131l A T 3: 83,938,152 D390E probably benign Het
Trim33 T A 3: 103,321,663 probably null Het
Usp54 A G 14: 20,561,610 V1046A probably benign Het
Vit G A 17: 78,624,984 G507R probably damaging Het
Vmn2r59 A G 7: 42,046,166 I274T probably damaging Het
Vmn2r67 T A 7: 85,155,709 K65M possibly damaging Het
Vmn2r86 C T 10: 130,446,698 G683E possibly damaging Het
Vwa8 T C 14: 79,098,431 probably null Het
Zdhhc14 A G 17: 5,731,504 D333G probably benign Het
Zufsp G A 10: 33,919,359 S568L probably damaging Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 71713523 nonsense probably null
IGL01291:Fcho1 APN 8 71712547 missense probably benign 0.08
IGL01473:Fcho1 APN 8 71712138 missense probably benign 0.03
IGL02021:Fcho1 APN 8 71721275 missense probably benign 0.06
IGL02086:Fcho1 APN 8 71716800 missense probably damaging 1.00
IGL02808:Fcho1 APN 8 71712541 missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 71717430 splice site probably benign
IGL03267:Fcho1 APN 8 71712299 unclassified probably benign
cameo UTSW 8 71716863 missense possibly damaging 0.92
Lesser UTSW 8 71712560 missense probably benign 0.00
Sidekick UTSW 8 71715725 missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 71712547 missense probably benign 0.08
R0003:Fcho1 UTSW 8 71708953 missense probably damaging 1.00
R0010:Fcho1 UTSW 8 71709999 missense probably damaging 1.00
R0020:Fcho1 UTSW 8 71716870 missense probably benign 0.11
R0363:Fcho1 UTSW 8 71717490 missense probably damaging 1.00
R0457:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0485:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0501:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0502:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0551:Fcho1 UTSW 8 71712174 missense probably benign 0.06
R0583:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0584:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0585:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0612:Fcho1 UTSW 8 71715524 missense probably damaging 1.00
R0614:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0647:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0841:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0842:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1034:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1036:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1399:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1618:Fcho1 UTSW 8 71710403 missense probably damaging 0.98
R1754:Fcho1 UTSW 8 71711246 missense probably benign
R1793:Fcho1 UTSW 8 71709022 nonsense probably null
R2073:Fcho1 UTSW 8 71710489 missense probably damaging 0.98
R2177:Fcho1 UTSW 8 71712261 missense probably damaging 1.00
R4072:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4074:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4076:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4606:Fcho1 UTSW 8 71712480 missense probably benign
R4732:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4733:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R5082:Fcho1 UTSW 8 71717185 missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 71717176 missense probably benign 0.00
R5185:Fcho1 UTSW 8 71714956 unclassified probably benign
R6025:Fcho1 UTSW 8 71712573 splice site probably null
R6624:Fcho1 UTSW 8 71709371 missense probably damaging 0.99
R6875:Fcho1 UTSW 8 71714425 splice site probably null
R7069:Fcho1 UTSW 8 71710497 splice site probably null
R7476:Fcho1 UTSW 8 71713546 missense probably damaging 1.00
R7512:Fcho1 UTSW 8 71716863 missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 71712276 missense probably benign 0.00
R8699:Fcho1 UTSW 8 71709633 missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 71717146 missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9447:Fcho1 UTSW 8 71717269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTTATCCACAGAGCGCCGC -3'
(R):5'- GCATGCATGAGAGCCACAAC -3'

Sequencing Primer
(F):5'- GTCGGCAGCCTTCTTGC -3'
(R):5'- AACCCAGCCTCTCCGGAG -3'
Posted On 2022-05-16