Incidental Mutation 'R9433:Muc16'
ID 713107
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Name mucin 16
Synonyms 1110008I14Rik, LOC385009
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9433 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 18495455-18674530 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18572641 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 6945 (Q6945L)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
AlphaFold no structure available at present
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: Q6945L

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T C 12: 81,419,949 T633A possibly damaging Het
Adgrv1 A T 13: 81,566,352 F937L probably benign Het
Adipor2 A T 6: 119,359,525 F159Y probably damaging Het
Ahcyl1 A G 3: 107,668,329 V380A probably damaging Het
Akp3 A G 1: 87,125,795 K157E probably benign Het
Arpc1a T A 5: 145,108,393 I364N possibly damaging Het
Bach1 C G 16: 87,719,715 S381R probably benign Het
Brms1l G A 12: 55,866,078 probably null Het
Camk1d A G 2: 5,675,966 S6P unknown Het
Ccdc112 C A 18: 46,290,973 V233L probably benign Het
Ccdc113 A T 8: 95,545,985 N240I possibly damaging Het
Ccdc6 T C 10: 70,169,121 V232A possibly damaging Het
Cct5 A G 15: 31,592,737 I409T possibly damaging Het
Cd96 A G 16: 46,035,935 Y583H probably damaging Het
Cdh22 C T 2: 165,112,409 V731M probably benign Het
Clcn1 C T 6: 42,305,560 P521S probably damaging Het
Clec18a C T 8: 111,081,690 A27T probably benign Het
Cnnm2 C T 19: 46,762,368 A199V probably benign Het
Copg1 G A 6: 87,903,496 A494T possibly damaging Het
Cpsf2 A G 12: 101,981,993 E16G probably damaging Het
Cyp2j5 T A 4: 96,664,007 I2F probably benign Het
Dgkg T A 16: 22,565,315 N463Y probably damaging Het
Dnah11 T C 12: 118,012,272 D2804G probably damaging Het
Efcab12 T C 6: 115,816,034 N488D probably benign Het
Etv5 G A 16: 22,435,918 P64L probably damaging Het
Fbrs A G 7: 127,485,100 E468G probably benign Het
Fcho1 A T 8: 71,716,824 M146K probably benign Het
Gad1 A T 2: 70,593,463 M405L Het
Gcc2 T A 10: 58,270,770 H609Q probably benign Het
Gm11983 A T 11: 6,836,902 M75K unknown Het
Gm4353 T A 7: 116,083,636 I237F probably damaging Het
Gm8251 A T 1: 44,056,508 V1810E possibly damaging Het
H1f0 C T 15: 79,028,747 P9L probably damaging Het
Hcn4 A G 9: 58,823,939 D143G unknown Het
Id1 T A 2: 152,736,510 V57D probably damaging Het
Ifna13 T C 4: 88,644,303 Q28R probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Lonrf2 G A 1: 38,836,457 probably benign Het
Magi3 C T 3: 104,015,157 A1415T probably benign Het
Mia2 A G 12: 59,101,585 E77G probably damaging Het
Nos2 G A 11: 78,959,664 R1116H probably damaging Het
Olfr1362 C T 13: 21,611,054 C305Y probably benign Het
Parpbp A C 10: 88,139,996 V85G probably benign Het
Pcmtd2 C T 2: 181,855,044 H273Y possibly damaging Het
Pcp4l1 C T 1: 171,174,429 G54D probably damaging Het
Pkdrej T C 15: 85,819,869 H622R probably benign Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Pnpla8 T C 12: 44,283,522 S286P probably damaging Het
Prss36 C T 7: 127,934,167 V631I probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Ranbp9 A T 13: 43,422,565 I222N probably damaging Het
Rev1 T C 1: 38,053,092 T1249A probably damaging Het
Ripply2 G T 9: 87,019,662 W80C probably damaging Het
Rnaseh2b C A 14: 62,365,273 P235Q probably benign Het
Sacs T A 14: 61,206,548 F2014L probably damaging Het
Serpinb9f A G 13: 33,334,255 N246S probably benign Het
Sh3pxd2a A T 19: 47,267,100 S1088T probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skint3 A G 4: 112,280,235 I367V probably benign Het
Slc20a2 G T 8: 22,561,195 E415* probably null Het
Slc5a1 T A 5: 33,152,681 S418T probably benign Het
Spats2 G T 15: 99,178,565 G175* probably null Het
Srebf1 A T 11: 60,204,189 F485L possibly damaging Het
St8sia4 A G 1: 95,627,639 V222A Het
Stab1 C T 14: 31,143,574 E1786K probably benign Het
Stat2 A G 10: 128,276,788 M58V probably benign Het
Stat5a A G 11: 100,875,044 T319A probably benign Het
Sufu A G 19: 46,397,093 probably benign Het
Tle6 T A 10: 81,591,046 I579F probably damaging Het
Tmem131l A T 3: 83,938,152 D390E probably benign Het
Trim33 T A 3: 103,321,663 probably null Het
Usp54 A G 14: 20,561,610 V1046A probably benign Het
Vit G A 17: 78,624,984 G507R probably damaging Het
Vmn2r59 A G 7: 42,046,166 I274T probably damaging Het
Vmn2r67 T A 7: 85,155,709 K65M possibly damaging Het
Vmn2r86 C T 10: 130,446,698 G683E possibly damaging Het
Vwa8 T C 14: 79,098,431 probably null Het
Zdhhc14 A G 17: 5,731,504 D333G probably benign Het
Zufsp G A 10: 33,919,359 S568L probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R7038_muc16_859 UTSW 9 18620468 missense probably damaging 0.99
Runneymeade UTSW 9 18579317 critical splice donor site probably null
slimey UTSW 9 18590698 missense probably damaging 1.00
viscous UTSW 9 18644732 missense unknown
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 splice site probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 splice site probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7921:Muc16 UTSW 9 18659318 missense unknown
R7922:Muc16 UTSW 9 18584825 missense probably benign 0.16
R7948:Muc16 UTSW 9 18642490 missense unknown
R7957:Muc16 UTSW 9 18643471 missense unknown
R7972:Muc16 UTSW 9 18645764 nonsense probably null
R7992:Muc16 UTSW 9 18656429 missense unknown
R7998:Muc16 UTSW 9 18639892 missense probably benign 0.04
R8014:Muc16 UTSW 9 18654875 missense unknown
R8033:Muc16 UTSW 9 18636606 missense probably benign 0.26
R8052:Muc16 UTSW 9 18659051 missense unknown
R8058:Muc16 UTSW 9 18660002 nonsense probably null
R8088:Muc16 UTSW 9 18519300 nonsense probably null
R8095:Muc16 UTSW 9 18584830 nonsense probably null
R8111:Muc16 UTSW 9 18592629 missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18658737 missense unknown
R8117:Muc16 UTSW 9 18508910 nonsense probably null
R8137:Muc16 UTSW 9 18645676 missense unknown
R8196:Muc16 UTSW 9 18645334 missense unknown
R8218:Muc16 UTSW 9 18637019 missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18642977 missense unknown
R8313:Muc16 UTSW 9 18525147 missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18658043 missense unknown
R8342:Muc16 UTSW 9 18658685 missense unknown
R8351:Muc16 UTSW 9 18659885 missense unknown
R8356:Muc16 UTSW 9 18658778 missense unknown
R8360:Muc16 UTSW 9 18525258 missense probably benign 0.01
R8418:Muc16 UTSW 9 18519630 missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18537511 missense probably damaging 0.99
R8437:Muc16 UTSW 9 18657924 missense unknown
R8463:Muc16 UTSW 9 18659139 missense unknown
R8466:Muc16 UTSW 9 18643148 missense unknown
R8512:Muc16 UTSW 9 18638192 missense probably benign 0.01
R8518:Muc16 UTSW 9 18519631 missense probably benign 0.12
R8556:Muc16 UTSW 9 18640937 missense probably benign 0.01
R8679:Muc16 UTSW 9 18646448 missense unknown
R8680:Muc16 UTSW 9 18644719 missense unknown
R8720:Muc16 UTSW 9 18641600 missense probably benign 0.01
R8729:Muc16 UTSW 9 18660050 missense unknown
R8736:Muc16 UTSW 9 18550843 nonsense probably null
R8739:Muc16 UTSW 9 18637298 missense probably benign 0.10
R8807:Muc16 UTSW 9 18656057 missense unknown
R8830:Muc16 UTSW 9 18646069 missense unknown
R8871:Muc16 UTSW 9 18656048 missense unknown
R8884:Muc16 UTSW 9 18644200 missense unknown
R8923:Muc16 UTSW 9 18638676 missense probably benign 0.01
R8948:Muc16 UTSW 9 18647233 missense unknown
R8949:Muc16 UTSW 9 18520925 critical splice donor site probably null
R8987:Muc16 UTSW 9 18551685 nonsense probably null
R8997:Muc16 UTSW 9 18607467 intron probably benign
R9013:Muc16 UTSW 9 18512773 missense possibly damaging 0.94
R9020:Muc16 UTSW 9 18638719 small insertion probably benign
R9036:Muc16 UTSW 9 18644679 missense unknown
R9040:Muc16 UTSW 9 18644786 nonsense probably null
R9065:Muc16 UTSW 9 18643009 missense unknown
R9089:Muc16 UTSW 9 18644550 missense unknown
R9098:Muc16 UTSW 9 18643679 missense unknown
R9100:Muc16 UTSW 9 18645670 missense unknown
R9128:Muc16 UTSW 9 18647582 missense unknown
R9169:Muc16 UTSW 9 18656528 missense unknown
R9180:Muc16 UTSW 9 18642742 missense unknown
R9191:Muc16 UTSW 9 18644810 missense unknown
R9203:Muc16 UTSW 9 18551688 missense unknown
R9208:Muc16 UTSW 9 18508537 missense probably damaging 0.99
R9232:Muc16 UTSW 9 18656040 missense unknown
R9240:Muc16 UTSW 9 18538013 missense unknown
R9254:Muc16 UTSW 9 18646171 missense unknown
R9330:Muc16 UTSW 9 18641036 missense probably benign 0.04
R9347:Muc16 UTSW 9 18660215 missense unknown
R9358:Muc16 UTSW 9 18642224 missense probably benign 0.01
R9359:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9379:Muc16 UTSW 9 18646171 missense unknown
R9403:Muc16 UTSW 9 18537764 critical splice donor site probably null
R9422:Muc16 UTSW 9 18641806 missense probably benign 0.01
R9438:Muc16 UTSW 9 18647732 missense unknown
R9442:Muc16 UTSW 9 18655328 missense unknown
R9453:Muc16 UTSW 9 18660765 missense unknown
R9467:Muc16 UTSW 9 18597035 missense probably benign 0.03
Z1177:Muc16 UTSW 9 18537571 missense probably benign 0.26
Z1177:Muc16 UTSW 9 18657861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAATACTCACTGCTGGGGCTGG -3'
(R):5'- CTCTCTTTATTTGGAAAATAATCAGGC -3'

Sequencing Primer
(F):5'- CAGTCTGGTGTGTGTAACCTACAG -3'
(R):5'- TCTGATCTTCCTAGGCCA -3'
Posted On 2022-05-16