Incidental Mutation 'R9433:Nos2'
ID 713120
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms Nos2a, NOS-II, Nos-2, iNOS
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9433 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78811613-78851052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78850490 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1116 (R1116H)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000073001] [ENSMUST00000108268] [ENSMUST00000108269] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000018610
AA Change: R1116H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: R1116H

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073001
SMART Domains Protein: ENSMUSP00000072764
Gene: ENSMUSG00000001123

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 222 352 5.38e-60 SMART
Gal-bind_lectin 228 352 1.33e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108268
SMART Domains Protein: ENSMUSP00000103903
Gene: ENSMUSG00000001123

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 192 322 5.38e-60 SMART
Gal-bind_lectin 198 322 1.33e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108269
SMART Domains Protein: ENSMUSP00000103904
Gene: ENSMUSG00000001123

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 223 353 5.38e-60 SMART
Gal-bind_lectin 229 353 1.33e-65 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T C 12: 81,466,723 (GRCm39) T633A possibly damaging Het
Adgrv1 A T 13: 81,714,471 (GRCm39) F937L probably benign Het
Adipor2 A T 6: 119,336,486 (GRCm39) F159Y probably damaging Het
Ahcyl1 A G 3: 107,575,645 (GRCm39) V380A probably damaging Het
Akp3 A G 1: 87,053,517 (GRCm39) K157E probably benign Het
Arpc1a T A 5: 145,045,203 (GRCm39) I364N possibly damaging Het
Bach1 C G 16: 87,516,603 (GRCm39) S381R probably benign Het
Brms1l G A 12: 55,912,863 (GRCm39) probably null Het
Camk1d A G 2: 5,680,777 (GRCm39) S6P unknown Het
Ccdc112 C A 18: 46,424,040 (GRCm39) V233L probably benign Het
Ccdc113 A T 8: 96,272,613 (GRCm39) N240I possibly damaging Het
Ccdc168 A T 1: 44,095,668 (GRCm39) V1810E possibly damaging Het
Ccdc6 T C 10: 70,004,951 (GRCm39) V232A possibly damaging Het
Cct5 A G 15: 31,592,883 (GRCm39) I409T possibly damaging Het
Cd96 A G 16: 45,856,298 (GRCm39) Y583H probably damaging Het
Cdh22 C T 2: 164,954,329 (GRCm39) V731M probably benign Het
Clcn1 C T 6: 42,282,494 (GRCm39) P521S probably damaging Het
Clec18a C T 8: 111,808,322 (GRCm39) A27T probably benign Het
Cnnm2 C T 19: 46,750,807 (GRCm39) A199V probably benign Het
Copg1 G A 6: 87,880,478 (GRCm39) A494T possibly damaging Het
Cpsf2 A G 12: 101,948,252 (GRCm39) E16G probably damaging Het
Cyp2j5 T A 4: 96,552,244 (GRCm39) I2F probably benign Het
Dgkg T A 16: 22,384,065 (GRCm39) N463Y probably damaging Het
Dnah11 T C 12: 117,976,007 (GRCm39) D2804G probably damaging Het
Efcab12 T C 6: 115,792,995 (GRCm39) N488D probably benign Het
Etv5 G A 16: 22,254,668 (GRCm39) P64L probably damaging Het
Fbrs A G 7: 127,084,272 (GRCm39) E468G probably benign Het
Fcho1 A T 8: 72,169,468 (GRCm39) M146K probably benign Het
Gad1 A T 2: 70,423,807 (GRCm39) M405L Het
Gcc2 T A 10: 58,106,592 (GRCm39) H609Q probably benign Het
Gm11983 A T 11: 6,786,902 (GRCm39) M75K unknown Het
Gm4353 T A 7: 115,682,871 (GRCm39) I237F probably damaging Het
H1f0 C T 15: 78,912,947 (GRCm39) P9L probably damaging Het
Hcn4 A G 9: 58,731,222 (GRCm39) D143G unknown Het
Id1 T A 2: 152,578,430 (GRCm39) V57D probably damaging Het
Ifna13 T C 4: 88,562,540 (GRCm39) Q28R probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Lonrf2 G A 1: 38,875,538 (GRCm39) probably benign Het
Magi3 C T 3: 103,922,473 (GRCm39) A1415T probably benign Het
Mia2 A G 12: 59,148,371 (GRCm39) E77G probably damaging Het
Muc16 T A 9: 18,483,937 (GRCm39) Q6945L probably benign Het
Or2w4 C T 13: 21,795,224 (GRCm39) C305Y probably benign Het
Parpbp A C 10: 87,975,858 (GRCm39) V85G probably benign Het
Pcmtd2 C T 2: 181,496,837 (GRCm39) H273Y possibly damaging Het
Pcp4l1 C T 1: 171,001,998 (GRCm39) G54D probably damaging Het
Pkdrej T C 15: 85,704,070 (GRCm39) H622R probably benign Het
Plxnd1 G T 6: 115,945,754 (GRCm39) D906E probably benign Het
Pnpla8 T C 12: 44,330,305 (GRCm39) S286P probably damaging Het
Prss36 C T 7: 127,533,339 (GRCm39) V631I probably benign Het
Ptpn9 A T 9: 56,964,010 (GRCm39) N381I possibly damaging Het
Ranbp9 A T 13: 43,576,041 (GRCm39) I222N probably damaging Het
Rev1 T C 1: 38,092,173 (GRCm39) T1249A probably damaging Het
Ripply2 G T 9: 86,901,715 (GRCm39) W80C probably damaging Het
Rnaseh2b C A 14: 62,602,722 (GRCm39) P235Q probably benign Het
Sacs T A 14: 61,443,997 (GRCm39) F2014L probably damaging Het
Serpinb9f A G 13: 33,518,238 (GRCm39) N246S probably benign Het
Sh3pxd2a A T 19: 47,255,539 (GRCm39) S1088T probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Skint3 A G 4: 112,137,432 (GRCm39) I367V probably benign Het
Slc20a2 G T 8: 23,051,211 (GRCm39) E415* probably null Het
Slc5a1 T A 5: 33,310,025 (GRCm39) S418T probably benign Het
Spats2 G T 15: 99,076,446 (GRCm39) G175* probably null Het
Srebf1 A T 11: 60,095,015 (GRCm39) F485L possibly damaging Het
St8sia4 A G 1: 95,555,364 (GRCm39) V222A Het
Stab1 C T 14: 30,865,531 (GRCm39) E1786K probably benign Het
Stat2 A G 10: 128,112,657 (GRCm39) M58V probably benign Het
Stat5a A G 11: 100,765,870 (GRCm39) T319A probably benign Het
Sufu A G 19: 46,385,532 (GRCm39) probably benign Het
Tle6 T A 10: 81,426,880 (GRCm39) I579F probably damaging Het
Tmem131l A T 3: 83,845,459 (GRCm39) D390E probably benign Het
Trim33 T A 3: 103,228,979 (GRCm39) probably null Het
Usp54 A G 14: 20,611,678 (GRCm39) V1046A probably benign Het
Vit G A 17: 78,932,413 (GRCm39) G507R probably damaging Het
Vmn2r59 A G 7: 41,695,590 (GRCm39) I274T probably damaging Het
Vmn2r67 T A 7: 84,804,917 (GRCm39) K65M possibly damaging Het
Vmn2r86 C T 10: 130,282,567 (GRCm39) G683E possibly damaging Het
Vwa8 T C 14: 79,335,871 (GRCm39) probably null Het
Zdhhc14 A G 17: 5,781,779 (GRCm39) D333G probably benign Het
Zup1 G A 10: 33,795,355 (GRCm39) S568L probably damaging Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78,848,278 (GRCm39) missense probably damaging 0.96
IGL01503:Nos2 APN 11 78,836,689 (GRCm39) splice site probably benign
IGL01789:Nos2 APN 11 78,835,483 (GRCm39) splice site probably benign
IGL02797:Nos2 APN 11 78,831,170 (GRCm39) missense probably damaging 1.00
IGL02968:Nos2 APN 11 78,828,463 (GRCm39) missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78,836,553 (GRCm39) missense probably damaging 1.00
R0265:Nos2 UTSW 11 78,828,428 (GRCm39) missense probably damaging 0.98
R0441:Nos2 UTSW 11 78,819,409 (GRCm39) missense probably benign 0.10
R0504:Nos2 UTSW 11 78,830,903 (GRCm39) missense probably damaging 1.00
R0570:Nos2 UTSW 11 78,826,187 (GRCm39) missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78,843,629 (GRCm39) missense probably benign 0.00
R1538:Nos2 UTSW 11 78,847,396 (GRCm39) missense probably benign 0.00
R3414:Nos2 UTSW 11 78,848,414 (GRCm39) missense probably benign 0.14
R3418:Nos2 UTSW 11 78,850,521 (GRCm39) missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78,820,602 (GRCm39) missense probably benign 0.01
R4492:Nos2 UTSW 11 78,840,921 (GRCm39) missense probably benign
R4632:Nos2 UTSW 11 78,848,417 (GRCm39) missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78,819,456 (GRCm39) missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78,813,140 (GRCm39) missense probably benign
R5214:Nos2 UTSW 11 78,846,267 (GRCm39) missense probably damaging 1.00
R5377:Nos2 UTSW 11 78,848,317 (GRCm39) missense probably benign 0.00
R5777:Nos2 UTSW 11 78,830,978 (GRCm39) missense probably null 1.00
R5834:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.01
R5930:Nos2 UTSW 11 78,828,741 (GRCm39) missense probably damaging 1.00
R6511:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R6706:Nos2 UTSW 11 78,835,549 (GRCm39) missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78,843,780 (GRCm39) missense probably damaging 0.99
R6762:Nos2 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78,836,092 (GRCm39) missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78,848,332 (GRCm39) missense probably benign 0.02
R6917:Nos2 UTSW 11 78,842,053 (GRCm39) missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.02
R7286:Nos2 UTSW 11 78,820,680 (GRCm39) missense probably damaging 1.00
R7367:Nos2 UTSW 11 78,840,916 (GRCm39) missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78,827,297 (GRCm39) nonsense probably null
R7411:Nos2 UTSW 11 78,835,681 (GRCm39) critical splice donor site probably null
R7469:Nos2 UTSW 11 78,843,797 (GRCm39) missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78,813,192 (GRCm39) nonsense probably null
R8694:Nos2 UTSW 11 78,836,515 (GRCm39) missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R8872:Nos2 UTSW 11 78,839,949 (GRCm39) missense probably damaging 0.99
R8952:Nos2 UTSW 11 78,836,089 (GRCm39) missense probably benign 0.00
R9580:Nos2 UTSW 11 78,828,457 (GRCm39) missense probably benign 0.01
R9612:Nos2 UTSW 11 78,839,984 (GRCm39) missense probably damaging 1.00
R9727:Nos2 UTSW 11 78,843,825 (GRCm39) missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78,822,472 (GRCm39) missense probably damaging 0.96
X0063:Nos2 UTSW 11 78,813,193 (GRCm39) missense probably benign 0.01
Z1177:Nos2 UTSW 11 78,822,498 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGGGTGTAATGGCAGCAATC -3'
(R):5'- GTACAATACTACTTGGTAGGGTGG -3'

Sequencing Primer
(F):5'- TGTAATGGCAGCAATCCAGAC -3'
(R):5'- CAATACTACTTGGTAGGGTGGAGGAG -3'
Posted On 2022-05-16