Incidental Mutation 'R9433:Nos2'
ID 713120
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms iNOS, Nos-2, Nos2a, NOS-II
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9433 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78920787-78960254 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78959664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1116 (R1116H)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000073001] [ENSMUST00000108268] [ENSMUST00000108269] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000018610
AA Change: R1116H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: R1116H

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073001
SMART Domains Protein: ENSMUSP00000072764
Gene: ENSMUSG00000001123

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 222 352 5.38e-60 SMART
Gal-bind_lectin 228 352 1.33e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108268
SMART Domains Protein: ENSMUSP00000103903
Gene: ENSMUSG00000001123

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 192 322 5.38e-60 SMART
Gal-bind_lectin 198 322 1.33e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108269
SMART Domains Protein: ENSMUSP00000103904
Gene: ENSMUSG00000001123

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 223 353 5.38e-60 SMART
Gal-bind_lectin 229 353 1.33e-65 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 T C 12: 81,419,949 T633A possibly damaging Het
Adgrv1 A T 13: 81,566,352 F937L probably benign Het
Adipor2 A T 6: 119,359,525 F159Y probably damaging Het
Ahcyl1 A G 3: 107,668,329 V380A probably damaging Het
Akp3 A G 1: 87,125,795 K157E probably benign Het
Arpc1a T A 5: 145,108,393 I364N possibly damaging Het
Bach1 C G 16: 87,719,715 S381R probably benign Het
Brms1l G A 12: 55,866,078 probably null Het
Camk1d A G 2: 5,675,966 S6P unknown Het
Ccdc112 C A 18: 46,290,973 V233L probably benign Het
Ccdc113 A T 8: 95,545,985 N240I possibly damaging Het
Ccdc6 T C 10: 70,169,121 V232A possibly damaging Het
Cct5 A G 15: 31,592,737 I409T possibly damaging Het
Cd96 A G 16: 46,035,935 Y583H probably damaging Het
Cdh22 C T 2: 165,112,409 V731M probably benign Het
Clcn1 C T 6: 42,305,560 P521S probably damaging Het
Clec18a C T 8: 111,081,690 A27T probably benign Het
Cnnm2 C T 19: 46,762,368 A199V probably benign Het
Copg1 G A 6: 87,903,496 A494T possibly damaging Het
Cpsf2 A G 12: 101,981,993 E16G probably damaging Het
Cyp2j5 T A 4: 96,664,007 I2F probably benign Het
Dgkg T A 16: 22,565,315 N463Y probably damaging Het
Dnah11 T C 12: 118,012,272 D2804G probably damaging Het
Efcab12 T C 6: 115,816,034 N488D probably benign Het
Etv5 G A 16: 22,435,918 P64L probably damaging Het
Fbrs A G 7: 127,485,100 E468G probably benign Het
Fcho1 A T 8: 71,716,824 M146K probably benign Het
Gad1 A T 2: 70,593,463 M405L Het
Gcc2 T A 10: 58,270,770 H609Q probably benign Het
Gm11983 A T 11: 6,836,902 M75K unknown Het
Gm4353 T A 7: 116,083,636 I237F probably damaging Het
Gm8251 A T 1: 44,056,508 V1810E possibly damaging Het
H1f0 C T 15: 79,028,747 P9L probably damaging Het
Hcn4 A G 9: 58,823,939 D143G unknown Het
Id1 T A 2: 152,736,510 V57D probably damaging Het
Ifna13 T C 4: 88,644,303 Q28R probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Lonrf2 G A 1: 38,836,457 probably benign Het
Magi3 C T 3: 104,015,157 A1415T probably benign Het
Mia2 A G 12: 59,101,585 E77G probably damaging Het
Muc16 T A 9: 18,572,641 Q6945L probably benign Het
Olfr1362 C T 13: 21,611,054 C305Y probably benign Het
Parpbp A C 10: 88,139,996 V85G probably benign Het
Pcmtd2 C T 2: 181,855,044 H273Y possibly damaging Het
Pcp4l1 C T 1: 171,174,429 G54D probably damaging Het
Pkdrej T C 15: 85,819,869 H622R probably benign Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Pnpla8 T C 12: 44,283,522 S286P probably damaging Het
Prss36 C T 7: 127,934,167 V631I probably benign Het
Ptpn9 A T 9: 57,056,726 N381I possibly damaging Het
Ranbp9 A T 13: 43,422,565 I222N probably damaging Het
Rev1 T C 1: 38,053,092 T1249A probably damaging Het
Ripply2 G T 9: 87,019,662 W80C probably damaging Het
Rnaseh2b C A 14: 62,365,273 P235Q probably benign Het
Sacs T A 14: 61,206,548 F2014L probably damaging Het
Serpinb9f A G 13: 33,334,255 N246S probably benign Het
Sh3pxd2a A T 19: 47,267,100 S1088T probably damaging Het
Shank1 G A 7: 44,312,918 S71N unknown Het
Skint3 A G 4: 112,280,235 I367V probably benign Het
Slc20a2 G T 8: 22,561,195 E415* probably null Het
Slc5a1 T A 5: 33,152,681 S418T probably benign Het
Spats2 G T 15: 99,178,565 G175* probably null Het
Srebf1 A T 11: 60,204,189 F485L possibly damaging Het
St8sia4 A G 1: 95,627,639 V222A Het
Stab1 C T 14: 31,143,574 E1786K probably benign Het
Stat2 A G 10: 128,276,788 M58V probably benign Het
Stat5a A G 11: 100,875,044 T319A probably benign Het
Sufu A G 19: 46,397,093 probably benign Het
Tle6 T A 10: 81,591,046 I579F probably damaging Het
Tmem131l A T 3: 83,938,152 D390E probably benign Het
Trim33 T A 3: 103,321,663 probably null Het
Usp54 A G 14: 20,561,610 V1046A probably benign Het
Vit G A 17: 78,624,984 G507R probably damaging Het
Vmn2r59 A G 7: 42,046,166 I274T probably damaging Het
Vmn2r67 T A 7: 85,155,709 K65M possibly damaging Het
Vmn2r86 C T 10: 130,446,698 G683E possibly damaging Het
Vwa8 T C 14: 79,098,431 probably null Het
Zdhhc14 A G 17: 5,731,504 D333G probably benign Het
Zufsp G A 10: 33,919,359 S568L probably damaging Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78959748 missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78922366 nonsense probably null
R8694:Nos2 UTSW 11 78945689 missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78955464 splice site probably null
R8872:Nos2 UTSW 11 78949123 missense probably damaging 0.99
R8952:Nos2 UTSW 11 78945263 missense probably benign 0.00
R9580:Nos2 UTSW 11 78937631 missense probably benign 0.01
R9612:Nos2 UTSW 11 78949158 missense probably damaging 1.00
R9727:Nos2 UTSW 11 78952999 missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78931646 missense probably damaging 0.96
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGGGTGTAATGGCAGCAATC -3'
(R):5'- GTACAATACTACTTGGTAGGGTGG -3'

Sequencing Primer
(F):5'- TGTAATGGCAGCAATCCAGAC -3'
(R):5'- CAATACTACTTGGTAGGGTGGAGGAG -3'
Posted On 2022-05-16