Incidental Mutation 'R9435:Gbf1'
ID 713259
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Name golgi-specific brefeldin A-resistance factor 1
Synonyms 1700083E03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9435 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46152509-46286510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46279993 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1322 (V1322A)
Ref Sequence ENSEMBL: ENSMUSP00000026254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000175747] [ENSMUST00000176992]
AlphaFold Q6DFZ1
Predicted Effect probably benign
Transcript: ENSMUST00000026254
AA Change: V1322A

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: V1322A

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175747
Predicted Effect probably benign
Transcript: ENSMUST00000176992
AA Change: V1268A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: V1268A

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,660,605 D1134E probably benign Het
Abca5 C T 11: 110,292,085 probably null Het
Acp2 A G 2: 91,206,064 T169A probably damaging Het
Agtpbp1 A T 13: 59,474,615 N932K probably benign Het
Aldh5a1 G A 13: 24,937,310 R87C probably damaging Het
Bpifa1 G T 2: 154,143,923 A53S unknown Het
Cacna2d2 T C 9: 107,519,185 I667T probably benign Het
Catsperg1 T A 7: 29,190,326 T784S probably benign Het
Ccdc93 C T 1: 121,441,855 Q109* probably null Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Cd46 C G 1: 195,085,412 D114H probably damaging Het
Cd82 A T 2: 93,437,395 L19Q probably damaging Het
Cnksr1 A G 4: 134,234,574 I180T possibly damaging Het
Drg2 T C 11: 60,468,140 V362A probably benign Het
Eef2 T A 10: 81,179,160 M231K probably benign Het
Egr2 T C 10: 67,539,798 Y75H probably damaging Het
Exoc6 A C 19: 37,597,097 Q473H probably benign Het
Focad T A 4: 88,348,839 M1029K unknown Het
Fpr-rs4 T A 17: 18,022,129 S133T probably benign Het
Gm13212 G C 4: 145,622,475 E161Q Het
Gm572 T C 4: 148,668,509 S282P possibly damaging Het
Gm7579 GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG 7: 142,212,045 probably benign Het
Golph3l T C 3: 95,589,058 V31A probably benign Het
Iars2 A T 1: 185,302,716 V610D probably damaging Het
Igsf6 T A 7: 121,067,249 I203F probably damaging Het
Ildr2 A G 1: 166,309,122 Y510C probably damaging Het
Iqcf4 C A 9: 106,568,453 R165L possibly damaging Het
Itgb1bp1 T G 12: 21,270,942 I183L possibly damaging Het
Itgb4 A C 11: 116,005,029 S1414R probably benign Het
Kbtbd7 G T 14: 79,427,504 A259S probably benign Het
Kif14 T A 1: 136,473,436 D508E possibly damaging Het
Klc2 A T 19: 5,109,634 D484E possibly damaging Het
Lamc2 T C 1: 153,137,326 S630G probably benign Het
Myl6b G A 10: 128,495,197 T125M possibly damaging Het
Nbea T A 3: 56,035,888 K655N possibly damaging Het
Nkx3-2 T C 5: 41,762,150 D165G probably benign Het
Npy A T 6: 49,827,501 R67S probably damaging Het
Nrg3 A T 14: 39,472,599 C68S possibly damaging Het
Nup160 C T 2: 90,729,794 P1288S probably damaging Het
Olfr672 T C 7: 104,996,739 H55R probably benign Het
Olfr952 A G 9: 39,426,210 L287P probably benign Het
Pam T A 1: 97,894,419 I287L probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Phf10 T C 17: 14,945,125 R490G probably benign Het
Prim2 T C 1: 33,484,795 Y345C probably damaging Het
Ptchd3 C T 11: 121,830,820 A173V probably benign Het
Rab8b G A 9: 66,848,630 R167W probably damaging Het
S100a3 A G 3: 90,602,195 E49G probably benign Het
Slc41a1 T A 1: 131,839,158 V138E probably damaging Het
Slit1 C A 19: 41,603,325 probably null Het
Sntg1 T A 1: 8,363,590 H479L probably damaging Het
Stam T A 2: 14,115,990 C72S probably damaging Het
Sval2 G T 6: 41,863,861 A93S probably benign Het
Tas2r103 T A 6: 133,036,723 K127* probably null Het
Trank1 C T 9: 111,364,822 T638M probably benign Het
Utrn T A 10: 12,643,429 I2260F probably damaging Het
Zfp280d T C 9: 72,319,317 probably null Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7650:Gbf1 UTSW 19 46272539 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
R8241:Gbf1 UTSW 19 46246137 missense probably damaging 1.00
R8716:Gbf1 UTSW 19 46284021 missense probably damaging 1.00
R8851:Gbf1 UTSW 19 46268483 missense probably damaging 1.00
R9424:Gbf1 UTSW 19 46259683 missense probably benign 0.00
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGAAAGATGTTGTCCAGACCTC -3'
(R):5'- ATATAAGCTGGGGCCCCATTC -3'

Sequencing Primer
(F):5'- TTGGTGATTGGGCCAAAGTAAGC -3'
(R):5'- ATTCCAAGCCAGACATCCTCTCTG -3'
Posted On 2022-05-16