Incidental Mutation 'R9436:Anapc1'
ID 713268
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Name anaphase promoting complex subunit 1
Synonyms 2610021O03Rik, tsg24, Apc1, Mcpr
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9436 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 128610104-128687391 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128676125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 270 (T270A)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
AlphaFold P53995
Predicted Effect probably benign
Transcript: ENSMUST00000014499
AA Change: T270A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: T270A

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110333
AA Change: T270A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: T270A

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A G 19: 31,932,575 T340A probably benign Het
Adamts2 G T 11: 50,803,680 R1098L probably benign Het
Add1 A T 5: 34,605,929 R154* probably null Het
Alpk1 A G 3: 127,685,275 V41A Het
Ankhd1 C A 18: 36,560,988 A84D probably benign Het
Ankhd1 T A 18: 36,641,601 C1412S probably benign Het
Ccdc93 C T 1: 121,441,855 Q109* probably null Het
Chrm5 T C 2: 112,479,479 R431G possibly damaging Het
Dnah14 A C 1: 181,680,783 E1842A probably damaging Het
Dync1h1 T C 12: 110,616,541 L386P probably damaging Het
Efcab1 T A 16: 14,917,677 C84* probably null Het
Eme1 G A 11: 94,647,681 Q393* probably null Het
Gm7714 A G 5: 88,282,398 D51G possibly damaging Het
Hinfp A T 9: 44,297,979 Y308N probably damaging Het
Hnrnph3 T A 10: 63,018,848 R55* probably null Het
Ifi44 T C 3: 151,749,249 D113G probably benign Het
Katnal1 A T 5: 148,878,951 L392H probably damaging Het
Kcnk12 C A 17: 87,797,452 M1I probably null Het
Krt17 T A 11: 100,257,499 D372V probably damaging Het
Mkl2 T A 16: 13,405,287 Y796* probably null Het
Myo3a T A 2: 22,407,424 Y751* probably null Het
Ndrg3 C A 2: 156,940,356 probably null Het
Nfkbib C A 7: 28,766,375 W16C probably damaging Het
Nlrp14 T C 7: 107,181,899 V101A probably benign Het
Npy5r A G 8: 66,680,831 S437P probably damaging Het
Olfr790 T C 10: 129,501,100 F64S probably damaging Het
Pcdhga3 G A 18: 37,675,091 R199H probably damaging Het
Pi4ka T A 16: 17,307,806 H1155L Het
Rbp3 A G 14: 33,955,277 D394G possibly damaging Het
Rnmt T A 18: 68,309,339 V180E probably damaging Het
Rpl3l A T 17: 24,728,326 K5* probably null Het
Rps6ka1 A T 4: 133,848,652 V652E probably damaging Het
Slc7a1 A T 5: 148,333,920 W579R probably damaging Het
Smyd4 T A 11: 75,402,191 L649Q probably damaging Het
Snx19 A G 9: 30,463,306 R954G possibly damaging Het
Sp4 T C 12: 118,238,265 E744G possibly damaging Het
Spag16 C T 1: 69,853,380 L107F probably damaging Het
Stk36 A G 1: 74,611,113 D268G probably benign Het
Tat G T 8: 109,991,860 G85W probably damaging Het
Tchp G T 5: 114,709,385 E88D probably benign Het
Tmem132b A G 5: 125,698,569 N369S possibly damaging Het
Tmf1 T C 6: 97,176,656 D152G probably benign Het
Ttc7 T C 17: 87,292,892 Y145H possibly damaging Het
Ttn T C 2: 76,941,919 I2592M unknown Het
Unc80 T G 1: 66,693,805 probably null Het
Vmn2r26 T C 6: 124,025,867 Y79H probably damaging Het
Whamm G T 7: 81,571,315 probably benign Het
Zfp184 A G 13: 21,949,728 I48M probably benign Het
Zfp974 A T 7: 27,911,669 F210L probably benign Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 splice site probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7960:Anapc1 UTSW 2 128674593 missense probably damaging 1.00
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
R8228:Anapc1 UTSW 2 128619917 nonsense probably null
R8402:Anapc1 UTSW 2 128630228 missense probably benign 0.02
R8422:Anapc1 UTSW 2 128675837 missense probably benign
R8425:Anapc1 UTSW 2 128669868 missense probably damaging 1.00
R8469:Anapc1 UTSW 2 128658344 splice site probably null
R8553:Anapc1 UTSW 2 128619913 missense possibly damaging 0.80
R8688:Anapc1 UTSW 2 128685828 missense probably benign 0.19
R8699:Anapc1 UTSW 2 128641453 missense probably damaging 1.00
R8719:Anapc1 UTSW 2 128641449 missense probably damaging 1.00
R8775:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8775-TAIL:Anapc1 UTSW 2 128657173 missense possibly damaging 0.92
R8806:Anapc1 UTSW 2 128622413 missense possibly damaging 0.67
R8973:Anapc1 UTSW 2 128664032 missense probably damaging 0.99
R8977:Anapc1 UTSW 2 128641402 missense probably damaging 1.00
R9000:Anapc1 UTSW 2 128634708 missense probably damaging 1.00
R9080:Anapc1 UTSW 2 128622506 missense possibly damaging 0.82
R9203:Anapc1 UTSW 2 128623502 missense possibly damaging 0.66
R9314:Anapc1 UTSW 2 128622500 missense possibly damaging 0.69
R9386:Anapc1 UTSW 2 128617722 missense probably benign 0.08
R9415:Anapc1 UTSW 2 128634678 missense probably benign
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCATTCTCTTCCTTAAGTCAAAGG -3'
(R):5'- GTAAACCTGCTGATATTCTGTCC -3'

Sequencing Primer
(F):5'- AGAGGTACTTTGCTTGAAATTACC -3'
(R):5'- GCTGATATTCTGTCCCTGGTC -3'
Posted On 2022-05-16