Incidental Mutation 'R9436:Vmn2r26'
ID 713280
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R9436 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124025867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 79 (Y79H)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: Y79H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: Y79H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A G 19: 31,932,575 T340A probably benign Het
Adamts2 G T 11: 50,803,680 R1098L probably benign Het
Add1 A T 5: 34,605,929 R154* probably null Het
Alpk1 A G 3: 127,685,275 V41A Het
Anapc1 T C 2: 128,676,125 T270A probably benign Het
Ankhd1 C A 18: 36,560,988 A84D probably benign Het
Ankhd1 T A 18: 36,641,601 C1412S probably benign Het
Ccdc93 C T 1: 121,441,855 Q109* probably null Het
Chrm5 T C 2: 112,479,479 R431G possibly damaging Het
Dnah14 A C 1: 181,680,783 E1842A probably damaging Het
Dync1h1 T C 12: 110,616,541 L386P probably damaging Het
Efcab1 T A 16: 14,917,677 C84* probably null Het
Eme1 G A 11: 94,647,681 Q393* probably null Het
Gm7714 A G 5: 88,282,398 D51G possibly damaging Het
Hinfp A T 9: 44,297,979 Y308N probably damaging Het
Hnrnph3 T A 10: 63,018,848 R55* probably null Het
Ifi44 T C 3: 151,749,249 D113G probably benign Het
Katnal1 A T 5: 148,878,951 L392H probably damaging Het
Kcnk12 C A 17: 87,797,452 M1I probably null Het
Krt17 T A 11: 100,257,499 D372V probably damaging Het
Mkl2 T A 16: 13,405,287 Y796* probably null Het
Myo3a T A 2: 22,407,424 Y751* probably null Het
Ndrg3 C A 2: 156,940,356 probably null Het
Nfkbib C A 7: 28,766,375 W16C probably damaging Het
Nlrp14 T C 7: 107,181,899 V101A probably benign Het
Npy5r A G 8: 66,680,831 S437P probably damaging Het
Olfr790 T C 10: 129,501,100 F64S probably damaging Het
Pcdhga3 G A 18: 37,675,091 R199H probably damaging Het
Pi4ka T A 16: 17,307,806 H1155L Het
Rbp3 A G 14: 33,955,277 D394G possibly damaging Het
Rnmt T A 18: 68,309,339 V180E probably damaging Het
Rpl3l A T 17: 24,728,326 K5* probably null Het
Rps6ka1 A T 4: 133,848,652 V652E probably damaging Het
Slc7a1 A T 5: 148,333,920 W579R probably damaging Het
Smyd4 T A 11: 75,402,191 L649Q probably damaging Het
Snx19 A G 9: 30,463,306 R954G possibly damaging Het
Sp4 T C 12: 118,238,265 E744G possibly damaging Het
Spag16 C T 1: 69,853,380 L107F probably damaging Het
Stk36 A G 1: 74,611,113 D268G probably benign Het
Tat G T 8: 109,991,860 G85W probably damaging Het
Tchp G T 5: 114,709,385 E88D probably benign Het
Tmem132b A G 5: 125,698,569 N369S possibly damaging Het
Tmf1 T C 6: 97,176,656 D152G probably benign Het
Ttc7 T C 17: 87,292,892 Y145H possibly damaging Het
Ttn T C 2: 76,941,919 I2592M unknown Het
Unc80 T G 1: 66,693,805 probably null Het
Whamm G T 7: 81,571,315 probably benign Het
Zfp184 A G 13: 21,949,728 I48M probably benign Het
Zfp974 A T 7: 27,911,669 F210L probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTCTTTATATGCCTTAGATTGCTG -3'
(R):5'- CTCGGGAGATCTGAATGGATATTGATG -3'

Sequencing Primer
(F):5'- atttgagagggagcactg -3'
(R):5'- GATGTTGAAATGCCTCCTATCACTG -3'
Posted On 2022-05-16