Mutagenetix > Incidental Mutation

Incidental Mutation 'R9438:Strc'

713352

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R9438 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121368166 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1415 (W1415R)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000000317

SMART Domains

Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	58	133	5.8e-34	PFAM
Pfam:ATP-gua_Ptrans	154	401	4.5e-98	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000038389
AA Change: W1415R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: W1415R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000078222

SMART Domains

Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	55	134	1.2e-37	PFAM
Pfam:ATP-gua_Ptrans	154	401	2e-105	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7420426K07Rik	G	A	9: 98,903,780	S166N	probably benign	Het
Acp2	G	A	2: 91,202,994	M20I	probably benign	Het
Adgra1	C	T	7: 139,852,609	P121L	probably benign	Het
Arhgap39	C	A	15: 76,751,918	R39L	probably damaging	Het
Atp1b3	A	T	9: 96,333,578	N261K	possibly damaging	Het
Atp8b3	C	T	10: 80,525,575	A838T	probably damaging	Het
B020031M17Rik	A	G	13: 119,949,827	L81P	probably benign	Het
Cacng8	G	A	7: 3,415,403	S357N	unknown	Het
Ccdc93	C	T	1: 121,441,855	Q109*	probably null	Het
Cdk19	T	A	10: 40,476,180	D319E	probably damaging	Het
Chd6	A	G	2: 160,957,158	S2336P	probably benign	Het
Cntn1	G	A	15: 92,246,143		probably null	Het
Cts6	G	A	13: 61,202,255	T4I	probably benign	Het
Ddt	A	T	10: 75,771,498	I98N	probably damaging	Het
Diaph1	A	C	18: 37,893,390	V465G	unknown	Het
Dnah2	G	T	11: 69,473,394	D2064E	probably damaging	Het
Dnmt1	T	C	9: 20,915,894	N969D	probably benign	Het
Dot1l	T	A	10: 80,791,286	V1447E	probably benign	Het
Efs	T	A	14: 54,919,411	D389V		Het
Fam26e	T	C	10: 34,096,053	M129V	probably benign	Het
Gbp11	T	A	5: 105,326,605	K402*	probably null	Het
Grm7	A	T	6: 111,254,116	D500V	possibly damaging	Het
Hecw1	T	C	13: 14,306,829	M439V	probably benign	Het
Ice1	A	G	13: 70,606,315	S551P	probably benign	Het
Igsf9b	T	C	9: 27,332,543	S779P	probably benign	Het
Itpr2	T	C	6: 146,166,668	N2437S	probably benign	Het
Kbtbd12	G	A	6: 88,614,058	Q391*	probably null	Het
Kcnma1	T	C	14: 23,367,585	I859V	probably benign	Het
Klri1	A	C	6: 129,698,916	D130E	probably benign	Het
Krt9	A	G	11: 100,188,998	Y523H	unknown	Het
Ldhc	G	T	7: 46,866,433	V51F	possibly damaging	Het
Macf1	G	T	4: 123,385,573	D5890E	probably benign	Het
Map4k4	A	G	1: 40,006,792	S613G	probably damaging	Het
Mrpl55	A	G	11: 59,205,755	D118G	probably damaging	Het
Muc16	T	C	9: 18,647,732	T2422A	unknown	Het
Nfkbib	T	A	7: 28,760,229	D219V	probably damaging	Het
Nsd2	A	G	5: 33,843,288	K50E	probably damaging	Het
Nudcd1	C	T	15: 44,405,925	R113H	probably benign	Het
Olfr476	A	T	7: 107,967,793	Y132F	probably damaging	Het
Olfr832	T	A	9: 18,945,030	C127*	probably null	Het
Olfr862	C	T	9: 19,883,787	E173K	probably benign	Het
Papln	A	T	12: 83,771,832	T63S	probably benign	Het
Pax4	T	C	6: 28,446,186	I103V	possibly damaging	Het
Pitpnm2	G	A	5: 124,131,279	H427Y	probably damaging	Het
Plk5	T	A	10: 80,358,033	V52E	probably damaging	Het
Rab44	A	G	17: 29,145,252	H600R	unknown	Het
Rbbp6	G	A	7: 123,000,233	V1256I		Het
Rexo1	T	A	10: 80,543,014	T1063S	possibly damaging	Het
Rp1l1	A	G	14: 64,028,125	R387G	possibly damaging	Het
Rufy3	T	C	5: 88,648,265	S603P	probably benign	Het
Setd1b	A	G	5: 123,147,881	H330R	unknown	Het
Terf2	C	A	8: 107,076,872	A359S	probably benign	Het
Tmod1	A	G	4: 46,093,958	N223S	probably damaging	Het
Tram2	T	A	1: 21,005,610	I195F	possibly damaging	Het
Trap1	T	C	16: 4,065,267	Q148R	probably benign	Het
Tsks	C	T	7: 44,957,671	R143*	probably null	Het
Ttc14	T	A	3: 33,804,712	H373Q	probably damaging	Het
Ttn	T	C	2: 76,917,404	K4434E	probably benign	Het
Usp7	T	C	16: 8,704,969	D347G	probably benign	Het
Vps13d	T	C	4: 145,131,744	E2170G		Het
Xrn1	T	C	9: 96,011,234	I1001T	probably benign	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGGCCTTTGTTTAACAGTC -3'
(R):5'- AGAGACATTTGCCACAGAGC -3'

Sequencing Primer
(F):5'- CAGTCTTGCCTGAAACAAGTTGC -3'
(R):5'- CATTTGCCACAGAGCTGGGATG -3'

Posted On

2022-05-16