Incidental Mutation 'R9438:Atp8b3'
ID 713388
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene Name ATPase, class I, type 8B, member 3
Synonyms 1700042F02Rik, 1700056N23Rik, SAPLT
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9438 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 80355418-80374958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 80361409 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 838 (A838T)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]
AlphaFold Q6UQ17
Predicted Effect probably damaging
Transcript: ENSMUST00000020383
AA Change: A838T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: A838T

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000220326
AA Change: G751D
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 G A 2: 91,033,339 (GRCm39) M20I probably benign Het
Adgra1 C T 7: 139,432,525 (GRCm39) P121L probably benign Het
Arhgap39 C A 15: 76,636,118 (GRCm39) R39L probably damaging Het
Atp1b3 A T 9: 96,215,631 (GRCm39) N261K possibly damaging Het
Cacng8 G A 7: 3,463,919 (GRCm39) S357N unknown Het
Calhm5 T C 10: 33,972,049 (GRCm39) M129V probably benign Het
Ccdc93 C T 1: 121,369,584 (GRCm39) Q109* probably null Het
Cdk19 T A 10: 40,352,176 (GRCm39) D319E probably damaging Het
Chd6 A G 2: 160,799,078 (GRCm39) S2336P probably benign Het
Cntn1 G A 15: 92,144,024 (GRCm39) probably null Het
Cts6 G A 13: 61,350,069 (GRCm39) T4I probably benign Het
Ddt A T 10: 75,607,332 (GRCm39) I98N probably damaging Het
Diaph1 A C 18: 38,026,443 (GRCm39) V465G unknown Het
Dnah2 G T 11: 69,364,220 (GRCm39) D2064E probably damaging Het
Dnmt1 T C 9: 20,827,190 (GRCm39) N969D probably benign Het
Dot1l T A 10: 80,627,120 (GRCm39) V1447E probably benign Het
Efs T A 14: 55,156,868 (GRCm39) D389V Het
Gbp11 T A 5: 105,474,471 (GRCm39) K402* probably null Het
Grm7 A T 6: 111,231,077 (GRCm39) D500V possibly damaging Het
Hecw1 T C 13: 14,481,414 (GRCm39) M439V probably benign Het
Ice1 A G 13: 70,754,434 (GRCm39) S551P probably benign Het
Igsf9b T C 9: 27,243,839 (GRCm39) S779P probably benign Het
Itpr2 T C 6: 146,068,166 (GRCm39) N2437S probably benign Het
Kbtbd12 G A 6: 88,591,040 (GRCm39) Q391* probably null Het
Kcnma1 T C 14: 23,417,653 (GRCm39) I859V probably benign Het
Klri1 A C 6: 129,675,879 (GRCm39) D130E probably benign Het
Krt9 A G 11: 100,079,824 (GRCm39) Y523H unknown Het
Ldhc G T 7: 46,515,857 (GRCm39) V51F possibly damaging Het
Macf1 G T 4: 123,279,366 (GRCm39) D5890E probably benign Het
Map4k4 A G 1: 40,045,952 (GRCm39) S613G probably damaging Het
Mrpl55 A G 11: 59,096,581 (GRCm39) D118G probably damaging Het
Muc16 T C 9: 18,559,028 (GRCm39) T2422A unknown Het
Nfkbib T A 7: 28,459,654 (GRCm39) D219V probably damaging Het
Nsd2 A G 5: 34,000,632 (GRCm39) K50E probably damaging Het
Nudcd1 C T 15: 44,269,321 (GRCm39) R113H probably benign Het
Or5p55 A T 7: 107,567,000 (GRCm39) Y132F probably damaging Het
Or7e170 C T 9: 19,795,083 (GRCm39) E173K probably benign Het
Or7g19 T A 9: 18,856,326 (GRCm39) C127* probably null Het
Papln A T 12: 83,818,606 (GRCm39) T63S probably benign Het
Pax4 T C 6: 28,446,185 (GRCm39) I103V possibly damaging Het
Pitpnm2 G A 5: 124,269,342 (GRCm39) H427Y probably damaging Het
Plk5 T A 10: 80,193,867 (GRCm39) V52E probably damaging Het
Prr23a4 G A 9: 98,785,833 (GRCm39) S166N probably benign Het
Rab44 A G 17: 29,364,226 (GRCm39) H600R unknown Het
Rbbp6 G A 7: 122,599,456 (GRCm39) V1256I Het
Rexo1 T A 10: 80,378,848 (GRCm39) T1063S possibly damaging Het
Rp1l1 A G 14: 64,265,574 (GRCm39) R387G possibly damaging Het
Rufy3 T C 5: 88,796,124 (GRCm39) S603P probably benign Het
Setd1b A G 5: 123,285,944 (GRCm39) H330R unknown Het
Strc A T 2: 121,198,647 (GRCm39) W1415R probably damaging Het
Tcstv5 A G 13: 120,411,363 (GRCm39) L81P probably benign Het
Terf2 C A 8: 107,803,504 (GRCm39) A359S probably benign Het
Tmod1 A G 4: 46,093,958 (GRCm39) N223S probably damaging Het
Tram2 T A 1: 21,075,834 (GRCm39) I195F possibly damaging Het
Trap1 T C 16: 3,883,131 (GRCm39) Q148R probably benign Het
Tsks C T 7: 44,607,095 (GRCm39) R143* probably null Het
Ttc14 T A 3: 33,858,861 (GRCm39) H373Q probably damaging Het
Ttn T C 2: 76,747,748 (GRCm39) K4434E probably benign Het
Usp7 T C 16: 8,522,833 (GRCm39) D347G probably benign Het
Vps13d T C 4: 144,858,314 (GRCm39) E2170G Het
Xrn1 T C 9: 95,893,287 (GRCm39) I1001T probably benign Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80,366,821 (GRCm39) missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80,361,998 (GRCm39) splice site probably benign
IGL00904:Atp8b3 APN 10 80,364,598 (GRCm39) missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80,360,210 (GRCm39) missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80,370,063 (GRCm39) splice site probably benign
IGL01448:Atp8b3 APN 10 80,356,256 (GRCm39) missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80,366,802 (GRCm39) nonsense probably null
IGL01754:Atp8b3 APN 10 80,366,795 (GRCm39) splice site probably null
IGL01809:Atp8b3 APN 10 80,355,845 (GRCm39) missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80,357,662 (GRCm39) missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80,363,067 (GRCm39) splice site probably benign
IGL02224:Atp8b3 APN 10 80,361,810 (GRCm39) splice site probably benign
IGL02377:Atp8b3 APN 10 80,356,128 (GRCm39) missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80,366,462 (GRCm39) missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80,366,438 (GRCm39) missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80,370,292 (GRCm39) missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80,366,420 (GRCm39) missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80,362,743 (GRCm39) missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80,355,918 (GRCm39) missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80,370,032 (GRCm39) missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80,366,852 (GRCm39) missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80,356,017 (GRCm39) missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80,368,376 (GRCm39) missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80,361,619 (GRCm39) missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80,357,635 (GRCm39) splice site probably null
R1717:Atp8b3 UTSW 10 80,364,631 (GRCm39) missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80,365,912 (GRCm39) missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80,361,220 (GRCm39) nonsense probably null
R2138:Atp8b3 UTSW 10 80,362,939 (GRCm39) missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80,366,822 (GRCm39) missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80,362,728 (GRCm39) missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80,370,017 (GRCm39) missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80,355,746 (GRCm39) missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80,372,181 (GRCm39) missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80,362,014 (GRCm39) missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80,365,540 (GRCm39) missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4518:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4519:Atp8b3 UTSW 10 80,359,681 (GRCm39) missense probably benign
R4619:Atp8b3 UTSW 10 80,361,858 (GRCm39) missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80,361,457 (GRCm39) missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80,372,604 (GRCm39) splice site probably null
R4774:Atp8b3 UTSW 10 80,372,156 (GRCm39) missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80,360,188 (GRCm39) missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80,357,676 (GRCm39) missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80,365,533 (GRCm39) missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80,356,007 (GRCm39) missense probably benign
R5990:Atp8b3 UTSW 10 80,361,531 (GRCm39) missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80,365,515 (GRCm39) missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80,356,157 (GRCm39) splice site probably null
R6748:Atp8b3 UTSW 10 80,361,058 (GRCm39) missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80,361,895 (GRCm39) missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80,365,552 (GRCm39) missense probably damaging 0.99
R7051:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7052:Atp8b3 UTSW 10 80,355,858 (GRCm39) missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80,365,926 (GRCm39) missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80,365,463 (GRCm39) critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80,360,240 (GRCm39) missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80,366,437 (GRCm39) missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80,366,858 (GRCm39) missense possibly damaging 0.95
R8235:Atp8b3 UTSW 10 80,365,650 (GRCm39) missense probably damaging 0.96
R8354:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8454:Atp8b3 UTSW 10 80,361,633 (GRCm39) missense probably benign 0.00
R8501:Atp8b3 UTSW 10 80,355,980 (GRCm39) missense probably benign
R8712:Atp8b3 UTSW 10 80,365,923 (GRCm39) missense possibly damaging 0.52
R8962:Atp8b3 UTSW 10 80,355,896 (GRCm39) missense probably benign 0.13
R9129:Atp8b3 UTSW 10 80,368,412 (GRCm39) missense probably damaging 1.00
R9333:Atp8b3 UTSW 10 80,360,180 (GRCm39) missense probably benign 0.01
R9486:Atp8b3 UTSW 10 80,366,821 (GRCm39) missense probably damaging 1.00
R9554:Atp8b3 UTSW 10 80,360,197 (GRCm39) missense probably damaging 1.00
R9570:Atp8b3 UTSW 10 80,361,822 (GRCm39) missense probably benign 0.05
R9682:Atp8b3 UTSW 10 80,371,230 (GRCm39) missense probably damaging 1.00
R9748:Atp8b3 UTSW 10 80,364,407 (GRCm39) missense probably damaging 0.96
RF006:Atp8b3 UTSW 10 80,362,070 (GRCm39) missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80,366,911 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGTCACAGCATCTTGTCAGC -3'
(R):5'- GTCCAGAATGCAGTGGTGGATG -3'

Sequencing Primer
(F):5'- ATCTTGTCAGCCATCGGGAC -3'
(R):5'- CTTCCTCCAGAAGCGGAGGATC -3'
Posted On 2022-05-16