Mutagenetix > Incidental Mutation

Incidental Mutation 'R9438:Atp8b3'

713388

Institutional Source

Beutler Lab

Gene Symbol

Atp8b3

Ensembl Gene

ENSMUSG00000003341

Gene Name

ATPase, class I, type 8B, member 3

Synonyms

1700042F02Rik, SAPLT, 1700056N23Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R9438 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80519584-80539124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80525575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 838 (A838T)

Ref Sequence

ENSEMBL: ENSMUSP00000020383 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000220326]

AlphaFold

Q6UQ17

Predicted Effect

probably damaging
Transcript: ENSMUST00000020383
AA Change: A838T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: A838T

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	20	97	9.3e-29	PFAM
Pfam:E1-E2_ATPase	121	367	2.2e-10	PFAM
Pfam:HAD	404	866	3.7e-17	PFAM
Pfam:Cation_ATPase	481	580	8.3e-12	PFAM
Pfam:PhoLip_ATPase_C	883	1135	4.2e-61	PFAM
low complexity region	1140	1153	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000220326
AA Change: G751D

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7420426K07Rik	G	A	9: 98,903,780	S166N	probably benign	Het
Acp2	G	A	2: 91,202,994	M20I	probably benign	Het
Adgra1	C	T	7: 139,852,609	P121L	probably benign	Het
Arhgap39	C	A	15: 76,751,918	R39L	probably damaging	Het
Atp1b3	A	T	9: 96,333,578	N261K	possibly damaging	Het
B020031M17Rik	A	G	13: 119,949,827	L81P	probably benign	Het
Cacng8	G	A	7: 3,415,403	S357N	unknown	Het
Ccdc93	C	T	1: 121,441,855	Q109*	probably null	Het
Cdk19	T	A	10: 40,476,180	D319E	probably damaging	Het
Chd6	A	G	2: 160,957,158	S2336P	probably benign	Het
Cntn1	G	A	15: 92,246,143		probably null	Het
Cts6	G	A	13: 61,202,255	T4I	probably benign	Het
Ddt	A	T	10: 75,771,498	I98N	probably damaging	Het
Diaph1	A	C	18: 37,893,390	V465G	unknown	Het
Dnah2	G	T	11: 69,473,394	D2064E	probably damaging	Het
Dnmt1	T	C	9: 20,915,894	N969D	probably benign	Het
Dot1l	T	A	10: 80,791,286	V1447E	probably benign	Het
Efs	T	A	14: 54,919,411	D389V		Het
Fam26e	T	C	10: 34,096,053	M129V	probably benign	Het
Gbp11	T	A	5: 105,326,605	K402*	probably null	Het
Grm7	A	T	6: 111,254,116	D500V	possibly damaging	Het
Hecw1	T	C	13: 14,306,829	M439V	probably benign	Het
Ice1	A	G	13: 70,606,315	S551P	probably benign	Het
Igsf9b	T	C	9: 27,332,543	S779P	probably benign	Het
Itpr2	T	C	6: 146,166,668	N2437S	probably benign	Het
Kbtbd12	G	A	6: 88,614,058	Q391*	probably null	Het
Kcnma1	T	C	14: 23,367,585	I859V	probably benign	Het
Klri1	A	C	6: 129,698,916	D130E	probably benign	Het
Krt9	A	G	11: 100,188,998	Y523H	unknown	Het
Ldhc	G	T	7: 46,866,433	V51F	possibly damaging	Het
Macf1	G	T	4: 123,385,573	D5890E	probably benign	Het
Map4k4	A	G	1: 40,006,792	S613G	probably damaging	Het
Mrpl55	A	G	11: 59,205,755	D118G	probably damaging	Het
Muc16	T	C	9: 18,647,732	T2422A	unknown	Het
Nfkbib	T	A	7: 28,760,229	D219V	probably damaging	Het
Nsd2	A	G	5: 33,843,288	K50E	probably damaging	Het
Nudcd1	C	T	15: 44,405,925	R113H	probably benign	Het
Olfr476	A	T	7: 107,967,793	Y132F	probably damaging	Het
Olfr832	T	A	9: 18,945,030	C127*	probably null	Het
Olfr862	C	T	9: 19,883,787	E173K	probably benign	Het
Papln	A	T	12: 83,771,832	T63S	probably benign	Het
Pax4	T	C	6: 28,446,186	I103V	possibly damaging	Het
Pitpnm2	G	A	5: 124,131,279	H427Y	probably damaging	Het
Plk5	T	A	10: 80,358,033	V52E	probably damaging	Het
Rab44	A	G	17: 29,145,252	H600R	unknown	Het
Rbbp6	G	A	7: 123,000,233	V1256I		Het
Rexo1	T	A	10: 80,543,014	T1063S	possibly damaging	Het
Rp1l1	A	G	14: 64,028,125	R387G	possibly damaging	Het
Rufy3	T	C	5: 88,648,265	S603P	probably benign	Het
Setd1b	A	G	5: 123,147,881	H330R	unknown	Het
Strc	A	T	2: 121,368,166	W1415R	probably damaging	Het
Terf2	C	A	8: 107,076,872	A359S	probably benign	Het
Tmod1	A	G	4: 46,093,958	N223S	probably damaging	Het
Tram2	T	A	1: 21,005,610	I195F	possibly damaging	Het
Trap1	T	C	16: 4,065,267	Q148R	probably benign	Het
Tsks	C	T	7: 44,957,671	R143*	probably null	Het
Ttc14	T	A	3: 33,804,712	H373Q	probably damaging	Het
Ttn	T	C	2: 76,917,404	K4434E	probably benign	Het
Usp7	T	C	16: 8,704,969	D347G	probably benign	Het
Vps13d	T	C	4: 145,131,744	E2170G		Het
Xrn1	T	C	9: 96,011,234	I1001T	probably benign	Het

Other mutations in Atp8b3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Atp8b3	APN	10	80530987	missense	probably damaging	1.00
IGL00484:Atp8b3	APN	10	80526164	splice site	probably benign
IGL00904:Atp8b3	APN	10	80528764	missense	probably damaging	1.00
IGL01326:Atp8b3	APN	10	80524376	missense	probably damaging	0.98
IGL01368:Atp8b3	APN	10	80534229	splice site	probably benign
IGL01448:Atp8b3	APN	10	80520422	missense	probably benign	0.02
IGL01556:Atp8b3	APN	10	80530968	nonsense	probably null
IGL01754:Atp8b3	APN	10	80530961	splice site	probably null
IGL01809:Atp8b3	APN	10	80520011	missense	probably benign	0.02
IGL01895:Atp8b3	APN	10	80521828	missense	possibly damaging	0.80
IGL02184:Atp8b3	APN	10	80527233	splice site	probably benign
IGL02224:Atp8b3	APN	10	80525976	splice site	probably benign
IGL02377:Atp8b3	APN	10	80520294	missense	probably benign	0.06
IGL02405:Atp8b3	APN	10	80530628	missense	probably damaging	1.00
IGL03090:Atp8b3	APN	10	80530604	missense	probably damaging	1.00
IGL03244:Atp8b3	APN	10	80534458	missense	probably damaging	1.00
PIT4544001:Atp8b3	UTSW	10	80530586	missense	probably benign	0.14
R0277:Atp8b3	UTSW	10	80526909	missense	probably benign	0.21
R0908:Atp8b3	UTSW	10	80520084	missense	probably benign	0.03
R0973:Atp8b3	UTSW	10	80534198	missense	probably damaging	1.00
R1069:Atp8b3	UTSW	10	80531018	missense	probably damaging	1.00
R1087:Atp8b3	UTSW	10	80520183	missense	probably benign	0.00
R1553:Atp8b3	UTSW	10	80532542	missense	probably damaging	1.00
R1603:Atp8b3	UTSW	10	80525785	missense	probably benign	0.06
R1606:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R1707:Atp8b3	UTSW	10	80521801	splice site	probably null
R1717:Atp8b3	UTSW	10	80528797	missense	probably damaging	1.00
R1876:Atp8b3	UTSW	10	80530078	missense	possibly damaging	0.70
R1939:Atp8b3	UTSW	10	80525386	nonsense	probably null
R2138:Atp8b3	UTSW	10	80527105	missense	possibly damaging	0.79
R2239:Atp8b3	UTSW	10	80530988	missense	probably damaging	1.00
R2429:Atp8b3	UTSW	10	80526894	missense	probably benign	0.02
R2696:Atp8b3	UTSW	10	80534183	missense	possibly damaging	0.94
R2910:Atp8b3	UTSW	10	80519912	missense	possibly damaging	0.90
R3424:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3425:Atp8b3	UTSW	10	80536347	missense	probably benign	0.35
R3432:Atp8b3	UTSW	10	80526180	missense	probably benign	0.10
R3841:Atp8b3	UTSW	10	80529706	missense	possibly damaging	0.95
R4515:Atp8b3	UTSW	10	80523847	missense	probably benign
R4518:Atp8b3	UTSW	10	80523847	missense	probably benign
R4519:Atp8b3	UTSW	10	80523847	missense	probably benign
R4619:Atp8b3	UTSW	10	80526024	missense	possibly damaging	0.67
R4648:Atp8b3	UTSW	10	80525623	missense	possibly damaging	0.94
R4709:Atp8b3	UTSW	10	80536770	splice site	probably null
R4774:Atp8b3	UTSW	10	80536322	missense	probably damaging	1.00
R4796:Atp8b3	UTSW	10	80524354	missense	probably damaging	1.00
R5000:Atp8b3	UTSW	10	80521842	missense	possibly damaging	0.82
R5398:Atp8b3	UTSW	10	80529699	missense	probably damaging	1.00
R5778:Atp8b3	UTSW	10	80520173	missense	probably benign
R5990:Atp8b3	UTSW	10	80525697	missense	possibly damaging	0.65
R6124:Atp8b3	UTSW	10	80529681	missense	probably damaging	1.00
R6427:Atp8b3	UTSW	10	80520323	splice site	probably null
R6748:Atp8b3	UTSW	10	80525224	missense	possibly damaging	0.56
R6756:Atp8b3	UTSW	10	80526061	missense	possibly damaging	0.76
R7051:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7051:Atp8b3	UTSW	10	80529718	missense	probably damaging	0.99
R7052:Atp8b3	UTSW	10	80520024	missense	probably benign	0.02
R7418:Atp8b3	UTSW	10	80530092	missense	probably damaging	0.99
R7426:Atp8b3	UTSW	10	80529629	critical splice donor site	probably null
R7625:Atp8b3	UTSW	10	80520146	missense	probably benign	0.00
R7673:Atp8b3	UTSW	10	80524406	missense	probably damaging	0.99
R7921:Atp8b3	UTSW	10	80530603	missense	probably damaging	1.00
R8077:Atp8b3	UTSW	10	80531024	missense	possibly damaging	0.95
R8235:Atp8b3	UTSW	10	80529816	missense	probably damaging	0.96
R8354:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8454:Atp8b3	UTSW	10	80525799	missense	probably benign	0.00
R8501:Atp8b3	UTSW	10	80520146	missense	probably benign
R8712:Atp8b3	UTSW	10	80530089	missense	possibly damaging	0.52
R8962:Atp8b3	UTSW	10	80520062	missense	probably benign	0.13
R9129:Atp8b3	UTSW	10	80532578	missense	probably damaging	1.00
R9333:Atp8b3	UTSW	10	80524346	missense	probably benign	0.01
R9486:Atp8b3	UTSW	10	80530987	missense	probably damaging	1.00
R9554:Atp8b3	UTSW	10	80524363	missense	probably damaging	1.00
R9570:Atp8b3	UTSW	10	80525988	missense	probably benign	0.05
R9682:Atp8b3	UTSW	10	80535396	missense	probably damaging	1.00
R9748:Atp8b3	UTSW	10	80528573	missense	probably damaging	0.96
RF006:Atp8b3	UTSW	10	80526236	missense	probably benign	0.15
Z1177:Atp8b3	UTSW	10	80531077	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGGTCACAGCATCTTGTCAGC -3'
(R):5'- GTCCAGAATGCAGTGGTGGATG -3'

Sequencing Primer
(F):5'- ATCTTGTCAGCCATCGGGAC -3'
(R):5'- CTTCCTCCAGAAGCGGAGGATC -3'

Posted On

2022-05-16