Incidental Mutation 'R9439:1110002E22Rik'
ID 713421
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock # R9439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 138066287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 412 (E412D)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: E412D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: E412D

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,956,292 V415D probably damaging Het
Ache A C 5: 137,290,923 D297A probably damaging Het
Armc9 T C 1: 86,156,965 I4T possibly damaging Het
Atp8b2 T A 3: 89,944,185 Y925F Het
Avpr1b T C 1: 131,600,291 L184P probably damaging Het
Cabin1 G A 10: 75,745,235 P419L probably damaging Het
Ccdc88c T C 12: 100,918,338 S1578G probably benign Het
Ccnd2 A T 6: 127,150,654 C40* probably null Het
Col6a3 A T 1: 90,816,433 I471N probably damaging Het
Cp A G 3: 19,992,507 probably null Het
Cyfip2 C T 11: 46,200,841 R1084Q probably damaging Het
D11Wsu47e C T 11: 113,692,403 Q519* probably null Het
Diaph1 A G 18: 37,896,359 probably null Het
Dnah6 T C 6: 73,035,347 N3713S possibly damaging Het
Dot1l G T 10: 80,785,604 R633L possibly damaging Het
Ehmt1 A T 2: 24,825,018 M809K probably damaging Het
Fcgbp C A 7: 28,104,011 A1680E possibly damaging Het
Flt1 A G 5: 147,578,397 F1072L probably damaging Het
Gm19410 G T 8: 35,781,656 A549S probably damaging Het
Gnat1 A T 9: 107,676,312 I249N Het
Gp2 T C 7: 119,454,210 Y176C probably damaging Het
Gpc2 G T 5: 138,278,986 Q60K probably benign Het
Gpsm2 T A 3: 108,703,081 E21V probably damaging Het
Igkv4-80 T A 6: 69,016,809 M33L probably benign Het
Il20ra C A 10: 19,743,003 H66Q probably benign Het
Kap C T 6: 133,851,987 D61N probably benign Het
Magi3 C T 3: 104,015,157 A1415T probably benign Het
Mpp7 A T 18: 7,461,692 Y60* probably null Het
Neil1 T A 9: 57,143,814 R294* probably null Het
Nkx6-3 A G 8: 23,153,762 S60G probably benign Het
Noc2l T A 4: 156,241,673 S406T possibly damaging Het
Olfr113 A G 17: 37,574,934 I163T probably benign Het
Olfr279 T C 15: 98,498,366 V298A possibly damaging Het
Olfr325 T C 11: 58,581,278 C145R probably benign Het
Olfr510 T C 7: 108,667,419 M1T probably null Het
Olfr616 T G 7: 103,564,842 I146L probably benign Het
Olfr92 A G 17: 37,111,313 V223A probably damaging Het
Paqr4 A G 17: 23,739,965 F21L probably damaging Het
Pcdha9 A G 18: 36,998,474 T199A probably benign Het
Pcdhgb7 T C 18: 37,751,864 L29P probably benign Het
Pfkl G A 10: 77,995,338 A323V probably damaging Het
Pik3r4 C A 9: 105,650,842 P465T probably damaging Het
Pitpnm2 A G 5: 124,136,126 S307P probably damaging Het
Pitpnm2 A G 5: 124,140,596 Y191H probably damaging Het
Plod3 G A 5: 136,994,182 V613I probably benign Het
Prr23a2 C T 9: 98,856,868 T93I probably damaging Het
Ptk6 T A 2: 181,198,413 M267L possibly damaging Het
Rabl6 C T 2: 25,602,420 probably null Het
Ralgapa2 T C 2: 146,412,138 H787R probably benign Het
Rfx8 T G 1: 39,685,509 M231L probably benign Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Smpd4 A G 16: 17,641,587 I625V probably benign Het
Tcf7l1 A G 6: 72,788,757 S66P probably damaging Het
Tsc22d1 G A 14: 76,506,459 V1007M probably damaging Het
Tspoap1 C T 11: 87,774,709 R758C probably damaging Het
Vmn1r210 A C 13: 22,827,227 H296Q possibly damaging Het
Zfp532 G A 18: 65,685,643 V857I probably benign Het
Zfyve9 T C 4: 108,644,341 T593A probably benign Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAGAAACGAGGATGCAC -3'
(R):5'- TGACAGGAGGATCTGGCTTG -3'

Sequencing Primer
(F):5'- CTGAGAAACGAGGATGCACACTAC -3'
(R):5'- AGGATCTGGCTTGCTGCACTC -3'
Posted On 2022-05-16