Incidental Mutation 'R9439:Pitpnm2'
ID 713424
Institutional Source Beutler Lab
Gene Symbol Pitpnm2
Ensembl Gene ENSMUSG00000029406
Gene Name phosphatidylinositol transfer protein, membrane-associated 2
Synonyms NIR3, RDGBA2, Rdgb2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 124118690-124249760 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124136126 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 307 (S307P)
Ref Sequence ENSEMBL: ENSMUSP00000124111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000159677] [ENSMUST00000161273] [ENSMUST00000161938] [ENSMUST00000162812]
AlphaFold Q6ZPQ6
Predicted Effect probably damaging
Transcript: ENSMUST00000086123
AA Change: S307P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: S307P

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159677
AA Change: S307P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143269
Gene: ENSMUSG00000029406
AA Change: S307P

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-130 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161273
AA Change: S307P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: S307P

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-129 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 945 7.5e-100 SMART
LNS2 1090 1221 3.1e-59 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161938
AA Change: S307P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: S307P

DomainStartEndE-ValueType
Pfam:IP_trans 1 251 7.5e-116 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 949 8.37e-104 SMART
LNS2 1094 1225 3.22e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162812
AA Change: S307P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: S307P

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,287 E412D probably benign Het
Aak1 T A 6: 86,956,292 V415D probably damaging Het
Ache A C 5: 137,290,923 D297A probably damaging Het
Armc9 T C 1: 86,156,965 I4T possibly damaging Het
Atp8b2 T A 3: 89,944,185 Y925F Het
Avpr1b T C 1: 131,600,291 L184P probably damaging Het
Cabin1 G A 10: 75,745,235 P419L probably damaging Het
Ccdc88c T C 12: 100,918,338 S1578G probably benign Het
Ccnd2 A T 6: 127,150,654 C40* probably null Het
Col6a3 A T 1: 90,816,433 I471N probably damaging Het
Cp A G 3: 19,992,507 probably null Het
Cyfip2 C T 11: 46,200,841 R1084Q probably damaging Het
D11Wsu47e C T 11: 113,692,403 Q519* probably null Het
Diaph1 A G 18: 37,896,359 probably null Het
Dnah6 T C 6: 73,035,347 N3713S possibly damaging Het
Dot1l G T 10: 80,785,604 R633L possibly damaging Het
Ehmt1 A T 2: 24,825,018 M809K probably damaging Het
Fcgbp C A 7: 28,104,011 A1680E possibly damaging Het
Flt1 A G 5: 147,578,397 F1072L probably damaging Het
Gm19410 G T 8: 35,781,656 A549S probably damaging Het
Gnat1 A T 9: 107,676,312 I249N Het
Gp2 T C 7: 119,454,210 Y176C probably damaging Het
Gpc2 G T 5: 138,278,986 Q60K probably benign Het
Gpsm2 T A 3: 108,703,081 E21V probably damaging Het
Igkv4-80 T A 6: 69,016,809 M33L probably benign Het
Il20ra C A 10: 19,743,003 H66Q probably benign Het
Kap C T 6: 133,851,987 D61N probably benign Het
Magi3 C T 3: 104,015,157 A1415T probably benign Het
Mpp7 A T 18: 7,461,692 Y60* probably null Het
Neil1 T A 9: 57,143,814 R294* probably null Het
Nkx6-3 A G 8: 23,153,762 S60G probably benign Het
Noc2l T A 4: 156,241,673 S406T possibly damaging Het
Olfr113 A G 17: 37,574,934 I163T probably benign Het
Olfr279 T C 15: 98,498,366 V298A possibly damaging Het
Olfr325 T C 11: 58,581,278 C145R probably benign Het
Olfr510 T C 7: 108,667,419 M1T probably null Het
Olfr616 T G 7: 103,564,842 I146L probably benign Het
Olfr92 A G 17: 37,111,313 V223A probably damaging Het
Paqr4 A G 17: 23,739,965 F21L probably damaging Het
Pcdha9 A G 18: 36,998,474 T199A probably benign Het
Pcdhgb7 T C 18: 37,751,864 L29P probably benign Het
Pfkl G A 10: 77,995,338 A323V probably damaging Het
Pik3r4 C A 9: 105,650,842 P465T probably damaging Het
Plod3 G A 5: 136,994,182 V613I probably benign Het
Prr23a2 C T 9: 98,856,868 T93I probably damaging Het
Ptk6 T A 2: 181,198,413 M267L possibly damaging Het
Rabl6 C T 2: 25,602,420 probably null Het
Ralgapa2 T C 2: 146,412,138 H787R probably benign Het
Rfx8 T G 1: 39,685,509 M231L probably benign Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Smpd4 A G 16: 17,641,587 I625V probably benign Het
Tcf7l1 A G 6: 72,788,757 S66P probably damaging Het
Tsc22d1 G A 14: 76,506,459 V1007M probably damaging Het
Tspoap1 C T 11: 87,774,709 R758C probably damaging Het
Vmn1r210 A C 13: 22,827,227 H296Q possibly damaging Het
Zfp532 G A 18: 65,685,643 V857I probably benign Het
Zfyve9 T C 4: 108,644,341 T593A probably benign Het
Other mutations in Pitpnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pitpnm2 APN 5 124121663 unclassified probably benign
IGL01660:Pitpnm2 APN 5 124123194 missense probably damaging 1.00
IGL02328:Pitpnm2 APN 5 124121414 missense probably damaging 0.99
IGL02340:Pitpnm2 APN 5 124130613 missense probably damaging 1.00
IGL02399:Pitpnm2 APN 5 124140758 splice site probably benign
IGL02719:Pitpnm2 APN 5 124140602 missense probably damaging 1.00
IGL03053:Pitpnm2 APN 5 124143601 missense probably damaging 1.00
IGL03083:Pitpnm2 APN 5 124133382 missense possibly damaging 0.92
PIT4131001:Pitpnm2 UTSW 5 124131115 missense probably benign 0.01
R0058:Pitpnm2 UTSW 5 124124030 missense probably damaging 1.00
R0437:Pitpnm2 UTSW 5 124131089 splice site probably benign
R0530:Pitpnm2 UTSW 5 124131201 missense probably damaging 1.00
R0568:Pitpnm2 UTSW 5 124140517 splice site probably benign
R0926:Pitpnm2 UTSW 5 124131209 missense probably benign 0.10
R1625:Pitpnm2 UTSW 5 124133433 missense probably benign 0.05
R2008:Pitpnm2 UTSW 5 124152621 start codon destroyed probably damaging 0.99
R2120:Pitpnm2 UTSW 5 124127269 missense probably damaging 1.00
R2354:Pitpnm2 UTSW 5 124122919 missense probably damaging 0.99
R2448:Pitpnm2 UTSW 5 124123994 missense probably damaging 1.00
R2509:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2510:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2511:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2520:Pitpnm2 UTSW 5 124129401 missense probably damaging 0.96
R2860:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R2861:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R4407:Pitpnm2 UTSW 5 124152615 missense possibly damaging 0.57
R4417:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R4426:Pitpnm2 UTSW 5 124142123 missense probably benign 0.32
R4458:Pitpnm2 UTSW 5 124121376 missense probably benign 0.00
R4610:Pitpnm2 UTSW 5 124125371 missense probably damaging 0.99
R4786:Pitpnm2 UTSW 5 124121743 nonsense probably null
R4903:Pitpnm2 UTSW 5 124152605 missense probably damaging 1.00
R5151:Pitpnm2 UTSW 5 124136386 missense probably damaging 1.00
R5315:Pitpnm2 UTSW 5 124121933 missense probably benign 0.18
R5592:Pitpnm2 UTSW 5 124142149 missense probably damaging 1.00
R5792:Pitpnm2 UTSW 5 124130321 nonsense probably null
R6846:Pitpnm2 UTSW 5 124131171 missense probably benign 0.00
R6983:Pitpnm2 UTSW 5 124133406 missense probably damaging 1.00
R7096:Pitpnm2 UTSW 5 124129261 missense possibly damaging 0.69
R7188:Pitpnm2 UTSW 5 124121303 missense probably benign 0.31
R7203:Pitpnm2 UTSW 5 124121459 missense probably damaging 0.96
R7237:Pitpnm2 UTSW 5 124125297 critical splice donor site probably null
R7257:Pitpnm2 UTSW 5 124125356 missense possibly damaging 0.88
R7622:Pitpnm2 UTSW 5 124122027 missense probably benign 0.39
R7677:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R7736:Pitpnm2 UTSW 5 124123030 missense possibly damaging 0.47
R7745:Pitpnm2 UTSW 5 124128705 missense probably benign 0.19
R8041:Pitpnm2 UTSW 5 124121456 missense probably damaging 1.00
R9070:Pitpnm2 UTSW 5 124121312 missense probably damaging 1.00
R9218:Pitpnm2 UTSW 5 124127281 missense probably damaging 0.97
R9423:Pitpnm2 UTSW 5 124133406 missense probably benign 0.05
R9438:Pitpnm2 UTSW 5 124131279 missense probably damaging 0.99
R9439:Pitpnm2 UTSW 5 124140596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGCTGGGTTCACTTCACG -3'
(R):5'- GGACTGACCATGGAGAAAATCC -3'

Sequencing Primer
(F):5'- CACCTGGTACCACTTAGAAA -3'
(R):5'- GAGGGAGGTGCAGCTCATG -3'
Posted On 2022-05-16