Mutagenetix > Incidental Mutation

Incidental Mutation 'R9439:Pitpnm2'

713424

Institutional Source

Beutler Lab

Gene Symbol

Pitpnm2

Ensembl Gene

ENSMUSG00000029406

Gene Name

phosphatidylinositol transfer protein, membrane-associated 2

Synonyms

NIR3, RDGBA2, Rdgb2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9439 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

124118690-124249760 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124136126 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 307 (S307P)

Ref Sequence

ENSEMBL: ENSMUSP00000124111 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000159677] [ENSMUST00000161273] [ENSMUST00000161938] [ENSMUST00000162812]

AlphaFold

Q6ZPQ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000086123
AA Change: S307P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: S307P

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	6.1e-132	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	507	515	N/A	INTRINSIC
Blast:DDHD	548	570	6e-7	BLAST
low complexity region	571	589	N/A	INTRINSIC
low complexity region	608	630	N/A	INTRINSIC
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	895	1.66e-98	SMART
LNS2	1040	1171	3.22e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159677
AA Change: S307P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143269
Gene: ENSMUSG00000029406
AA Change: S307P

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	3.2e-130	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161273
AA Change: S307P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: S307P

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	3.2e-129	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
Blast:DDHD	422	670	2e-65	BLAST
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	945	7.5e-100	SMART
LNS2	1090	1221	3.1e-59	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161938
AA Change: S307P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: S307P

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	251	7.5e-116	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
Blast:DDHD	422	670	2e-65	BLAST
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	949	8.37e-104	SMART
LNS2	1094	1225	3.22e-55	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162812
AA Change: S307P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: S307P

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	6.1e-132	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	507	515	N/A	INTRINSIC
Blast:DDHD	548	570	6e-7	BLAST
low complexity region	571	589	N/A	INTRINSIC
low complexity region	608	630	N/A	INTRINSIC
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	895	1.66e-98	SMART
LNS2	1040	1171	3.22e-55	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,066,287	E412D	probably benign	Het
Aak1	T	A	6: 86,956,292	V415D	probably damaging	Het
Ache	A	C	5: 137,290,923	D297A	probably damaging	Het
Armc9	T	C	1: 86,156,965	I4T	possibly damaging	Het
Atp8b2	T	A	3: 89,944,185	Y925F		Het
Avpr1b	T	C	1: 131,600,291	L184P	probably damaging	Het
Cabin1	G	A	10: 75,745,235	P419L	probably damaging	Het
Ccdc88c	T	C	12: 100,918,338	S1578G	probably benign	Het
Ccnd2	A	T	6: 127,150,654	C40*	probably null	Het
Col6a3	A	T	1: 90,816,433	I471N	probably damaging	Het
Cp	A	G	3: 19,992,507		probably null	Het
Cyfip2	C	T	11: 46,200,841	R1084Q	probably damaging	Het
D11Wsu47e	C	T	11: 113,692,403	Q519*	probably null	Het
Diaph1	A	G	18: 37,896,359		probably null	Het
Dnah6	T	C	6: 73,035,347	N3713S	possibly damaging	Het
Dot1l	G	T	10: 80,785,604	R633L	possibly damaging	Het
Ehmt1	A	T	2: 24,825,018	M809K	probably damaging	Het
Fcgbp	C	A	7: 28,104,011	A1680E	possibly damaging	Het
Flt1	A	G	5: 147,578,397	F1072L	probably damaging	Het
Gm19410	G	T	8: 35,781,656	A549S	probably damaging	Het
Gnat1	A	T	9: 107,676,312	I249N		Het
Gp2	T	C	7: 119,454,210	Y176C	probably damaging	Het
Gpc2	G	T	5: 138,278,986	Q60K	probably benign	Het
Gpsm2	T	A	3: 108,703,081	E21V	probably damaging	Het
Igkv4-80	T	A	6: 69,016,809	M33L	probably benign	Het
Il20ra	C	A	10: 19,743,003	H66Q	probably benign	Het
Kap	C	T	6: 133,851,987	D61N	probably benign	Het
Magi3	C	T	3: 104,015,157	A1415T	probably benign	Het
Mpp7	A	T	18: 7,461,692	Y60*	probably null	Het
Neil1	T	A	9: 57,143,814	R294*	probably null	Het
Nkx6-3	A	G	8: 23,153,762	S60G	probably benign	Het
Noc2l	T	A	4: 156,241,673	S406T	possibly damaging	Het
Olfr113	A	G	17: 37,574,934	I163T	probably benign	Het
Olfr279	T	C	15: 98,498,366	V298A	possibly damaging	Het
Olfr325	T	C	11: 58,581,278	C145R	probably benign	Het
Olfr510	T	C	7: 108,667,419	M1T	probably null	Het
Olfr616	T	G	7: 103,564,842	I146L	probably benign	Het
Olfr92	A	G	17: 37,111,313	V223A	probably damaging	Het
Paqr4	A	G	17: 23,739,965	F21L	probably damaging	Het
Pcdha9	A	G	18: 36,998,474	T199A	probably benign	Het
Pcdhgb7	T	C	18: 37,751,864	L29P	probably benign	Het
Pfkl	G	A	10: 77,995,338	A323V	probably damaging	Het
Pik3r4	C	A	9: 105,650,842	P465T	probably damaging	Het
Plod3	G	A	5: 136,994,182	V613I	probably benign	Het
Prr23a2	C	T	9: 98,856,868	T93I	probably damaging	Het
Ptk6	T	A	2: 181,198,413	M267L	possibly damaging	Het
Rabl6	C	T	2: 25,602,420		probably null	Het
Ralgapa2	T	C	2: 146,412,138	H787R	probably benign	Het
Rfx8	T	G	1: 39,685,509	M231L	probably benign	Het
Rnf126	A	T	10: 79,761,631	I149N	probably damaging	Het
Smpd4	A	G	16: 17,641,587	I625V	probably benign	Het
Tcf7l1	A	G	6: 72,788,757	S66P	probably damaging	Het
Tsc22d1	G	A	14: 76,506,459	V1007M	probably damaging	Het
Tspoap1	C	T	11: 87,774,709	R758C	probably damaging	Het
Vmn1r210	A	C	13: 22,827,227	H296Q	possibly damaging	Het
Zfp532	G	A	18: 65,685,643	V857I	probably benign	Het
Zfyve9	T	C	4: 108,644,341	T593A	probably benign	Het

Other mutations in Pitpnm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Pitpnm2	APN	5	124121663	unclassified	probably benign
IGL01660:Pitpnm2	APN	5	124123194	missense	probably damaging	1.00
IGL02328:Pitpnm2	APN	5	124121414	missense	probably damaging	0.99
IGL02340:Pitpnm2	APN	5	124130613	missense	probably damaging	1.00
IGL02399:Pitpnm2	APN	5	124140758	splice site	probably benign
IGL02719:Pitpnm2	APN	5	124140602	missense	probably damaging	1.00
IGL03053:Pitpnm2	APN	5	124143601	missense	probably damaging	1.00
IGL03083:Pitpnm2	APN	5	124133382	missense	possibly damaging	0.92
PIT4131001:Pitpnm2	UTSW	5	124131115	missense	probably benign	0.01
R0058:Pitpnm2	UTSW	5	124124030	missense	probably damaging	1.00
R0437:Pitpnm2	UTSW	5	124131089	splice site	probably benign
R0530:Pitpnm2	UTSW	5	124131201	missense	probably damaging	1.00
R0568:Pitpnm2	UTSW	5	124140517	splice site	probably benign
R0926:Pitpnm2	UTSW	5	124131209	missense	probably benign	0.10
R1625:Pitpnm2	UTSW	5	124133433	missense	probably benign	0.05
R2008:Pitpnm2	UTSW	5	124152621	start codon destroyed	probably damaging	0.99
R2120:Pitpnm2	UTSW	5	124127269	missense	probably damaging	1.00
R2354:Pitpnm2	UTSW	5	124122919	missense	probably damaging	0.99
R2448:Pitpnm2	UTSW	5	124123994	missense	probably damaging	1.00
R2509:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2510:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2511:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2520:Pitpnm2	UTSW	5	124129401	missense	probably damaging	0.96
R2860:Pitpnm2	UTSW	5	124121437	missense	probably damaging	1.00
R2861:Pitpnm2	UTSW	5	124121437	missense	probably damaging	1.00
R4407:Pitpnm2	UTSW	5	124152615	missense	possibly damaging	0.57
R4417:Pitpnm2	UTSW	5	124123569	missense	probably damaging	1.00
R4426:Pitpnm2	UTSW	5	124142123	missense	probably benign	0.32
R4458:Pitpnm2	UTSW	5	124121376	missense	probably benign	0.00
R4610:Pitpnm2	UTSW	5	124125371	missense	probably damaging	0.99
R4786:Pitpnm2	UTSW	5	124121743	nonsense	probably null
R4903:Pitpnm2	UTSW	5	124152605	missense	probably damaging	1.00
R5151:Pitpnm2	UTSW	5	124136386	missense	probably damaging	1.00
R5315:Pitpnm2	UTSW	5	124121933	missense	probably benign	0.18
R5592:Pitpnm2	UTSW	5	124142149	missense	probably damaging	1.00
R5792:Pitpnm2	UTSW	5	124130321	nonsense	probably null
R6846:Pitpnm2	UTSW	5	124131171	missense	probably benign	0.00
R6983:Pitpnm2	UTSW	5	124133406	missense	probably damaging	1.00
R7096:Pitpnm2	UTSW	5	124129261	missense	possibly damaging	0.69
R7188:Pitpnm2	UTSW	5	124121303	missense	probably benign	0.31
R7203:Pitpnm2	UTSW	5	124121459	missense	probably damaging	0.96
R7237:Pitpnm2	UTSW	5	124125297	critical splice donor site	probably null
R7257:Pitpnm2	UTSW	5	124125356	missense	possibly damaging	0.88
R7622:Pitpnm2	UTSW	5	124122027	missense	probably benign	0.39
R7677:Pitpnm2	UTSW	5	124123569	missense	probably damaging	1.00
R7736:Pitpnm2	UTSW	5	124123030	missense	possibly damaging	0.47
R7745:Pitpnm2	UTSW	5	124128705	missense	probably benign	0.19
R8041:Pitpnm2	UTSW	5	124121456	missense	probably damaging	1.00
R9070:Pitpnm2	UTSW	5	124121312	missense	probably damaging	1.00
R9218:Pitpnm2	UTSW	5	124127281	missense	probably damaging	0.97
R9423:Pitpnm2	UTSW	5	124133406	missense	probably benign	0.05
R9438:Pitpnm2	UTSW	5	124131279	missense	probably damaging	0.99
R9439:Pitpnm2	UTSW	5	124140596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGGCTGGGTTCACTTCACG -3'
(R):5'- GGACTGACCATGGAGAAAATCC -3'

Sequencing Primer
(F):5'- CACCTGGTACCACTTAGAAA -3'
(R):5'- GAGGGAGGTGCAGCTCATG -3'

Posted On

2022-05-16