Incidental Mutation 'R8912:Cfap46'
ID 713470
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8912 (G1)
Quality Score 105.008
Status Validated
Chromosome 7
Chromosomal Location 139600951-139683817 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to T at 139680181 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000130453] [ENSMUST00000140820]
AlphaFold E9Q2C0
Predicted Effect probably benign
Transcript: ENSMUST00000129990
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130453
SMART Domains Protein: ENSMUSP00000115437
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 116 149 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000140820
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik C T 5: 113,723,706 W34* probably null Het
Adck5 T C 15: 76,593,235 S90P probably damaging Het
Adgra3 C A 5: 49,960,931 A1092S possibly damaging Het
Arhgap33 A T 7: 30,533,042 probably benign Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Atp6ap1l T A 13: 90,898,860 probably null Het
BC022687 T C 12: 112,815,703 V320A possibly damaging Het
Brd2 A T 17: 34,113,484 probably benign Het
Ciao1 A G 2: 127,246,679 V108A possibly damaging Het
Dnah3 T A 7: 120,090,646 H22L probably benign Het
Dnajc6 A G 4: 101,611,316 Y251C probably damaging Het
Dsg2 T A 18: 20,582,821 N273K probably damaging Het
Egf A G 3: 129,737,515 V137A possibly damaging Het
Ercc6 C T 14: 32,526,254 P254L probably benign Het
Erh G T 12: 80,637,508 A65E probably benign Het
Fbln2 A G 6: 91,263,438 E789G possibly damaging Het
Fbxl13 T G 5: 21,522,186 D571A probably damaging Het
Fbxw26 T A 9: 109,732,649 E159V probably damaging Het
Fndc1 T C 17: 7,800,946 I134V probably null Het
Fsip2 A G 2: 82,980,594 D2419G probably benign Het
Gm15448 A T 7: 3,822,819 D350E unknown Het
Gm3371 T C 14: 44,403,781 K109E Het
Gm5414 A G 15: 101,628,185 S2P possibly damaging Het
Igkv1-110 G T 6: 68,270,966 D20Y probably damaging Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Ippk A G 13: 49,450,037 D422G probably damaging Het
Irs2 A T 8: 11,006,655 D592E probably damaging Het
Klra9 A G 6: 130,182,405 I215T probably damaging Het
Lrrc8b T A 5: 105,481,558 L590Q probably damaging Het
Myh10 A G 11: 68,790,103 probably null Het
Neto1 A G 18: 86,461,048 D159G probably damaging Het
Nr1d2 T C 14: 18,220,030 K104E probably damaging Het
Nrcam T C 12: 44,598,583 V1256A probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Olfr1160 C T 2: 88,006,317 A145T possibly damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Olfr187 A G 16: 59,035,900 V279A probably benign Het
Olfr70 T A 4: 43,697,017 D52V probably benign Het
Patj A G 4: 98,497,328 H444R Het
Pclo T C 5: 14,775,321 L1356P Het
Pde4dip A G 3: 97,710,317 S1732P probably damaging Het
Pi4ka A T 16: 17,389,366 I25N Het
Pou2f3 C A 9: 43,199,039 V30L probably benign Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Reck T A 4: 43,938,802 probably benign Het
Sdha A T 13: 74,327,204 probably benign Het
Serinc1 A C 10: 57,523,979 S191A probably benign Het
Sgo2a T C 1: 58,017,401 S915P probably damaging Het
Sgsh T C 11: 119,352,660 T79A probably damaging Het
Sik1 A G 17: 31,850,945 V207A possibly damaging Het
Skap1 A T 11: 96,754,076 I338F probably damaging Het
Sowahc G T 10: 59,221,991 probably benign Het
Spata31d1d T C 13: 59,727,322 K800E possibly damaging Het
Spin1 T A 13: 51,144,397 W151R probably damaging Het
Srfbp1 A G 18: 52,490,614 T438A possibly damaging Het
Srrm2 A G 17: 23,819,601 T1740A probably benign Het
Tacr1 A T 6: 82,557,033 S347C probably damaging Het
Taf1b T C 12: 24,516,861 S185P possibly damaging Het
Tanc2 C T 11: 105,867,327 T638I probably benign Het
Tdrkh T C 3: 94,429,171 Y472H probably damaging Het
Trav4-2 C G 14: 53,418,809 Y89* probably null Het
Trpm1 G T 7: 64,268,880 R1540L probably benign Het
Ttc21a T C 9: 119,941,301 probably null Het
Ttc37 T A 13: 76,157,242 probably benign Het
Tti1 A G 2: 158,009,268 V17A probably benign Het
Vamp8 A G 6: 72,388,293 L44P probably benign Het
Vmn1r63 G T 7: 5,803,132 S167Y probably damaging Het
Xrn2 T C 2: 147,049,993 V710A probably benign Het
Zfp518a A C 19: 40,913,426 K600Q possibly damaging Het
Zfyve28 T C 5: 34,217,311 D453G probably benign Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139605644 missense
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8920:Cfap46 UTSW 7 139652526 missense
R8977:Cfap46 UTSW 7 139679933 missense probably benign 0.01
R9048:Cfap46 UTSW 7 139627343 missense unknown
R9224:Cfap46 UTSW 7 139678500 nonsense probably null
R9252:Cfap46 UTSW 7 139618249 missense unknown
R9276:Cfap46 UTSW 7 139621291 missense unknown
R9301:Cfap46 UTSW 7 139642545 missense
R9391:Cfap46 UTSW 7 139618111 missense unknown
R9402:Cfap46 UTSW 7 139635949 missense unknown
R9443:Cfap46 UTSW 7 139615107 missense
R9564:Cfap46 UTSW 7 139651555 missense not run
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGAACTTGGTAGCATCCTC -3'
(R):5'- CAGTTCAAGTCCAGACCTCAG -3'

Sequencing Primer
(F):5'- CCGGCTTGCAGGTAACATTCAAG -3'
(R):5'- GTTCAAGTCCAGACCTCAGCCTAC -3'
Posted On 2022-05-19