Incidental Mutation 'R8967:Phkb'
ID 713489
Institutional Source Beutler Lab
Gene Symbol Phkb
Ensembl Gene ENSMUSG00000036879
Gene Name phosphorylase kinase beta
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock # R8967 (G1)
Quality Score 193.009
Status Validated
Chromosome 8
Chromosomal Location 85840959-86061376 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to A at 86029434 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000053771]
AlphaFold Q7TSH2
Predicted Effect probably benign
Transcript: ENSMUST00000053771
SMART Domains Protein: ENSMUSP00000050788
Gene: ENSMUSG00000036879

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 39 870 1.5e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160731
SMART Domains Protein: ENSMUSP00000125051
Gene: ENSMUSG00000036879

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 26 301 2.2e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, encoded by this gene, which is a member of the phosphorylase b kinase regulatory subunit family. The gamma subunit also includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9B, also known as phosphorylase kinase deficiency of liver and muscle. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. Two pseudogenes have been found on chromosomes 14 and 20, respectively.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,292,696 S1520P probably benign Het
Abhd12 A G 2: 150,837,431 Y291H probably damaging Het
Abr C A 11: 76,479,029 S178I possibly damaging Het
Akap13 T A 7: 75,729,134 I422K possibly damaging Het
Arfgef2 A T 2: 166,835,742 T185S probably damaging Het
Arfip2 A T 7: 105,637,134 Y228N probably damaging Het
B4gat1 T C 19: 5,039,650 V225A probably damaging Het
Brf1 G A 12: 112,973,619 P183S probably damaging Het
Ceacam1 T C 7: 25,463,872 N312S possibly damaging Het
Cep135 T C 5: 76,603,318 L337P probably damaging Het
Cnppd1 A T 1: 75,136,621 C334* probably null Het
Cpxm2 A T 7: 132,059,835 Y408N probably damaging Het
Dennd3 T C 15: 73,547,577 V739A possibly damaging Het
Dlx3 T C 11: 95,123,751 Y287H probably damaging Het
Dnah7a A T 1: 53,643,435 probably benign Het
Dnah9 C A 11: 66,125,112 probably null Het
Dnajc1 A T 2: 18,308,946 Y121* probably null Het
Ecel1 A T 1: 87,151,140 Y526N probably damaging Het
Ect2 A T 3: 27,144,983 V218E probably damaging Het
Heca A G 10: 17,914,990 probably null Het
Hsd17b7 A T 1: 169,969,116 L6* probably null Het
Irgc1 T A 7: 24,433,312 T27S probably benign Het
Lama3 A C 18: 12,532,039 I671L possibly damaging Het
Mybl2 T C 2: 163,072,886 L308P probably damaging Het
Nicn1 C T 9: 108,294,509 R163C possibly damaging Het
Nphp1 G A 2: 127,740,977 P672L probably damaging Het
Oas3 G A 5: 120,758,842 H905Y probably damaging Het
Obscn A G 11: 59,081,914 V2102A probably benign Het
Olfr1208 A T 2: 88,897,500 Y32* probably null Het
Olfr218 A G 1: 173,203,472 T39A probably benign Het
Olfr352 A T 2: 36,870,054 T163S probably damaging Het
Olfr47 T C 6: 43,236,139 F177S probably damaging Het
Olfr5 A G 7: 6,481,012 L48P possibly damaging Het
Pank4 C G 4: 154,970,958 H262D probably benign Het
Pxylp1 G A 9: 96,825,271 T286M probably damaging Het
Pygm A T 19: 6,384,714 D79V probably damaging Het
Rapgef4 A G 2: 72,226,510 T682A possibly damaging Het
Sec24b C T 3: 129,991,435 R974Q probably damaging Het
Serpinb6e A G 13: 33,836,436 F230L possibly damaging Het
Skint6 A T 4: 112,872,504 L850* probably null Het
Slc7a11 C A 3: 50,384,115 V282L probably benign Het
Smg1 A G 7: 118,166,516 S1895P unknown Het
Tango2 A G 16: 18,347,899 probably benign Het
Tmc7 G A 7: 118,561,005 P203L probably benign Het
Tmem64 T A 4: 15,266,575 F208L probably damaging Het
Tpcn1 A T 5: 120,555,958 V191E probably damaging Het
Wdr63 T A 3: 146,055,640 N654Y possibly damaging Het
Zbtb41 A G 1: 139,442,849 I675V probably benign Het
Zfp180 T C 7: 24,105,301 S382P probably damaging Het
Zfp932 A G 5: 110,009,017 S194G probably benign Het
Other mutations in Phkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Phkb APN 8 85957587 missense probably benign 0.42
IGL01126:Phkb APN 8 85946101 missense probably benign 0.12
IGL01700:Phkb APN 8 86017465 missense probably benign 0.06
IGL01761:Phkb APN 8 86019064 missense probably benign 0.01
IGL02404:Phkb APN 8 85878115 missense possibly damaging 0.94
IGL02672:Phkb APN 8 85942358 missense probably benign
IGL02682:Phkb APN 8 85875646 makesense probably null
IGL02693:Phkb APN 8 85942234 missense probably damaging 1.00
IGL02798:Phkb APN 8 86043777 missense probably benign
IGL02888:Phkb APN 8 85935472 critical splice donor site probably null
IGL03106:Phkb APN 8 86018466 splice site probably benign
PIT4544001:Phkb UTSW 8 86011637 missense probably benign 0.42
R0088:Phkb UTSW 8 85942391 critical splice donor site probably null
R0107:Phkb UTSW 8 86016931 missense probably benign 0.01
R0504:Phkb UTSW 8 86056524 missense probably benign
R0569:Phkb UTSW 8 86017402 missense probably damaging 1.00
R0671:Phkb UTSW 8 85875693 missense probably damaging 0.97
R0894:Phkb UTSW 8 86017441 missense probably damaging 1.00
R1491:Phkb UTSW 8 85875657 missense possibly damaging 0.90
R1502:Phkb UTSW 8 86059339 missense possibly damaging 0.69
R1595:Phkb UTSW 8 86026553 splice site probably benign
R1686:Phkb UTSW 8 86021649 missense probably benign
R1913:Phkb UTSW 8 85901920 missense possibly damaging 0.95
R1919:Phkb UTSW 8 85922161 missense probably benign 0.17
R1968:Phkb UTSW 8 85970951 missense probably benign 0.07
R2008:Phkb UTSW 8 86056467 missense probably damaging 1.00
R2051:Phkb UTSW 8 86049821 critical splice donor site probably null
R2148:Phkb UTSW 8 86017486 missense probably damaging 0.96
R2305:Phkb UTSW 8 86043802 missense possibly damaging 0.80
R3801:Phkb UTSW 8 85922229 nonsense probably null
R3804:Phkb UTSW 8 85922229 nonsense probably null
R4159:Phkb UTSW 8 86021533 splice site probably null
R4624:Phkb UTSW 8 85848712 intron probably benign
R4833:Phkb UTSW 8 85901911 missense probably damaging 1.00
R5017:Phkb UTSW 8 86049809 missense probably benign
R5169:Phkb UTSW 8 85896491 missense probably benign 0.01
R5337:Phkb UTSW 8 85878245 missense probably damaging 1.00
R5391:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5395:Phkb UTSW 8 86017468 missense probably damaging 1.00
R5480:Phkb UTSW 8 85922182 missense probably damaging 1.00
R5538:Phkb UTSW 8 85922127 missense possibly damaging 0.80
R5623:Phkb UTSW 8 85843048 unclassified probably benign
R5753:Phkb UTSW 8 85878230 missense probably damaging 1.00
R5909:Phkb UTSW 8 86021447 critical splice donor site probably null
R5929:Phkb UTSW 8 85970914 missense probably benign 0.01
R6093:Phkb UTSW 8 85942329 missense probably damaging 1.00
R6320:Phkb UTSW 8 85875698 missense probably benign 0.00
R6324:Phkb UTSW 8 86018542 missense probably benign 0.00
R6626:Phkb UTSW 8 85922151 missense probably damaging 0.96
R6687:Phkb UTSW 8 86029546 missense probably damaging 1.00
R6848:Phkb UTSW 8 86029617 missense probably damaging 0.99
R7228:Phkb UTSW 8 85843007 unclassified probably benign
R7260:Phkb UTSW 8 85878130 missense probably benign 0.07
R7271:Phkb UTSW 8 86043789 missense probably damaging 1.00
R7314:Phkb UTSW 8 85942392 splice site probably null
R7586:Phkb UTSW 8 86029597 missense probably damaging 1.00
R7654:Phkb UTSW 8 85940887 missense possibly damaging 0.91
R7958:Phkb UTSW 8 86021663 missense probably benign 0.00
R8269:Phkb UTSW 8 86029582 missense probably benign 0.42
R8811:Phkb UTSW 8 86018527 missense possibly damaging 0.58
R9176:Phkb UTSW 8 85970994 missense probably damaging 0.96
R9350:Phkb UTSW 8 86016864 nonsense probably null
R9465:Phkb UTSW 8 85896430 missense probably damaging 1.00
X0021:Phkb UTSW 8 86029635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGCCCTTACATTTTAGACC -3'
(R):5'- CAGGGCTGTTGGAGATGATC -3'

Sequencing Primer
(F):5'- TTTTAGACCAGACTCAACCATCATGG -3'
(R):5'- AAGGCACCTAGAGTTACC -3'
Posted On 2022-05-19