Incidental Mutation 'R8947:Ehmt2'
ID 713542
Institutional Source Beutler Lab
Gene Symbol Ehmt2
Ensembl Gene ENSMUSG00000013787
Gene Name euchromatic histone lysine N-methyltransferase 2
Synonyms KMT1C, D17Ertd710e, NG36, G9a, Bat8
MMRRC Submission 068785-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8947 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 35117445-35133028 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35127280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 131 (E131G)
Ref Sequence ENSEMBL: ENSMUSP00000134749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013931] [ENSMUST00000078061] [ENSMUST00000097342] [ENSMUST00000114033] [ENSMUST00000124846] [ENSMUST00000137071]
AlphaFold Q9Z148
Predicted Effect probably benign
Transcript: ENSMUST00000013931
SMART Domains Protein: ENSMUSP00000013931
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 604 627 N/A INTRINSIC
ANK 737 766 2.52e-6 SMART
ANK 770 799 1.19e-2 SMART
ANK 803 833 4.71e-6 SMART
ANK 837 866 2.9e-6 SMART
ANK 870 899 1e0 SMART
ANK 903 932 1.53e-5 SMART
PreSET 976 1075 2.44e-40 SMART
SET 1091 1214 4.08e-46 SMART
PostSET 1217 1233 2.84e-1 SMART
low complexity region 1245 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078061
SMART Domains Protein: ENSMUSP00000077208
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
ANK 646 675 2.52e-6 SMART
ANK 679 708 1.19e-2 SMART
ANK 712 742 4.71e-6 SMART
ANK 746 775 2.9e-6 SMART
ANK 779 808 1e0 SMART
ANK 812 841 1.53e-5 SMART
PreSET 885 984 2.44e-40 SMART
SET 1000 1123 4.08e-46 SMART
PostSET 1126 1142 2.84e-1 SMART
low complexity region 1154 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097342
SMART Domains Protein: ENSMUSP00000094955
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
ANK 703 732 2.52e-6 SMART
ANK 736 765 1.19e-2 SMART
ANK 769 799 4.71e-6 SMART
ANK 803 832 2.9e-6 SMART
ANK 836 865 1e0 SMART
ANK 869 898 1.53e-5 SMART
PreSET 942 1041 2.44e-40 SMART
SET 1057 1180 4.08e-46 SMART
PostSET 1183 1199 2.84e-1 SMART
low complexity region 1211 1226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114033
SMART Domains Protein: ENSMUSP00000109667
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
ANK 680 709 2.52e-6 SMART
ANK 713 742 1.19e-2 SMART
ANK 746 776 4.71e-6 SMART
ANK 780 809 2.9e-6 SMART
ANK 813 842 1e0 SMART
ANK 846 875 1.53e-5 SMART
PreSET 919 1018 2.44e-40 SMART
SET 1034 1157 4.08e-46 SMART
PostSET 1160 1176 2.84e-1 SMART
low complexity region 1188 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124846
SMART Domains Protein: ENSMUSP00000121838
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 115 138 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
ANK 258 287 2.52e-6 SMART
ANK 291 320 1.19e-2 SMART
ANK 324 354 4.71e-6 SMART
ANK 358 387 2.9e-6 SMART
ANK 391 420 1e0 SMART
Pfam:Ank 424 442 3.4e-4 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137071
AA Change: E131G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134749
Gene: ENSMUSG00000013787
AA Change: E131G

DomainStartEndE-ValueType
ANK 23 52 1.19e-2 SMART
ANK 56 86 4.71e-6 SMART
ANK 90 119 2.9e-6 SMART
low complexity region 143 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172921
SMART Domains Protein: ENSMUSP00000134089
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
ANK 24 53 1.19e-2 SMART
ANK 57 87 4.71e-6 SMART
ANK 89 118 1e0 SMART
ANK 122 151 1.53e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E9.5-E12.5. Mutant embryos are developmentally delayed. Conditional deletion in germ cells results in infertility and arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T A 16: 4,665,292 (GRCm39) F141L unknown Het
A2ml1 G T 6: 128,529,219 (GRCm39) N974K probably damaging Het
Abcg8 T C 17: 84,999,246 (GRCm39) L114P probably damaging Het
Akt3 A T 1: 176,958,645 (GRCm39) W22R probably damaging Het
Ank2 C T 3: 126,736,396 (GRCm39) probably benign Het
Ap1g1 C T 8: 110,589,964 (GRCm39) probably benign Het
Arhgef19 T A 4: 140,973,618 (GRCm39) V35E possibly damaging Het
Baz2b T C 2: 59,778,583 (GRCm39) D759G probably benign Het
BC051665 C A 13: 60,930,004 (GRCm39) G320W probably damaging Het
Bche T A 3: 73,608,761 (GRCm39) T222S probably damaging Het
C8a T C 4: 104,679,326 (GRCm39) D444G probably damaging Het
Cacna1e A T 1: 154,277,896 (GRCm39) S2019T probably benign Het
Carm1 T C 9: 21,497,749 (GRCm39) I373T probably damaging Het
Ccdc39 T C 3: 33,869,609 (GRCm39) probably benign Het
Clic5 A T 17: 44,553,148 (GRCm39) probably benign Het
Cntn3 A G 6: 102,414,864 (GRCm39) F28L probably damaging Het
Col6a5 C T 9: 105,822,833 (GRCm39) E175K unknown Het
Cpb2 T C 14: 75,515,627 (GRCm39) Y352H probably damaging Het
Cpeb3 A T 19: 37,152,366 (GRCm39) D3E probably damaging Het
Ctsl T C 13: 64,514,840 (GRCm39) T155A probably damaging Het
Cygb C T 11: 116,540,645 (GRCm39) A114T probably damaging Het
Cyp11a1 T C 9: 57,924,738 (GRCm39) V17A probably benign Het
Dhcr7 T G 7: 143,400,959 (GRCm39) I374S probably damaging Het
Dhx36 T C 3: 62,380,387 (GRCm39) R807G probably benign Het
Diaph1 A T 18: 37,986,754 (GRCm39) V1077E probably damaging Het
Evpl A G 11: 116,112,164 (GRCm39) I1842T probably damaging Het
Fastk C A 5: 24,646,649 (GRCm39) C294F probably damaging Het
Fndc5 T C 4: 129,030,929 (GRCm39) C20R probably benign Het
Gm7298 C A 6: 121,757,553 (GRCm39) Q1053K possibly damaging Het
Gm8362 A G 14: 18,151,405 (GRCm39) probably null Het
Gmps T A 3: 63,906,098 (GRCm39) I465N probably damaging Het
Heatr4 T G 12: 84,001,431 (GRCm39) M904L probably benign Het
Hhip T A 8: 80,771,785 (GRCm39) D175V probably damaging Het
Hmcn2 G A 2: 31,278,220 (GRCm39) V1641M probably damaging Het
Hoxa5 T G 6: 52,179,776 (GRCm39) T200P probably damaging Het
Ift122 C A 6: 115,901,368 (GRCm39) A1050D probably benign Het
Igf2bp2 C A 16: 21,897,473 (GRCm39) E247* probably null Het
Irak1bp1 T A 9: 82,728,846 (GRCm39) L259H probably damaging Het
Irgm1 G A 11: 48,759,575 (GRCm39) probably benign Het
Itih1 A T 14: 30,657,866 (GRCm39) probably benign Het
Itpk1 A T 12: 102,536,582 (GRCm39) C355S probably benign Het
Kcng4 T C 8: 120,352,452 (GRCm39) E486G possibly damaging Het
Kif20b T C 19: 34,918,629 (GRCm39) V671A possibly damaging Het
Kif28 T G 1: 179,544,320 (GRCm39) I345L possibly damaging Het
Klri2 C G 6: 129,710,742 (GRCm39) probably null Het
Kntc1 T C 5: 123,925,041 (GRCm39) V1118A probably benign Het
Lpin2 T A 17: 71,511,871 (GRCm39) I34N probably benign Het
Lrch3 T A 16: 32,802,199 (GRCm39) V264D possibly damaging Het
Lrrk2 C T 15: 91,586,473 (GRCm39) Q430* probably null Het
Map10 T G 8: 126,397,839 (GRCm39) S411A probably benign Het
Map1a A T 2: 121,135,450 (GRCm39) I2089F probably benign Het
Med12l T A 3: 58,984,443 (GRCm39) probably benign Het
Mypn T A 10: 63,005,156 (GRCm39) Q317L probably damaging Het
Ncan T A 8: 70,555,171 (GRCm39) I999F probably damaging Het
Nmrk2 C A 10: 81,035,539 (GRCm39) R134L probably damaging Het
Or4k42 C T 2: 111,320,042 (GRCm39) V154I probably benign Het
Or51f1d T A 7: 102,701,315 (GRCm39) V270E probably damaging Het
Or5k17 T C 16: 58,746,433 (GRCm39) N167S probably benign Het
Or6z7 A G 7: 6,483,246 (GRCm39) V303A probably benign Het
Or8b1c T A 9: 38,384,685 (GRCm39) I214N probably damaging Het
Osbpl1a A G 18: 12,899,858 (GRCm39) probably null Het
Pcdh1 T C 18: 38,332,073 (GRCm39) D310G possibly damaging Het
Pkn2 C T 3: 142,517,674 (GRCm39) probably null Het
Plch1 T A 3: 63,691,547 (GRCm39) M31L probably damaging Het
Polg2 A G 11: 106,659,170 (GRCm39) F448L probably damaging Het
Ppp4r3b A G 11: 29,150,758 (GRCm39) T475A possibly damaging Het
Prdm13 C T 4: 21,678,817 (GRCm39) E558K probably damaging Het
Prdm9 T A 17: 15,764,270 (GRCm39) I837F possibly damaging Het
R3hdm1 T A 1: 128,102,694 (GRCm39) M125K possibly damaging Het
Rbm39 A T 2: 155,990,276 (GRCm39) V468E probably damaging Het
Rnasel T A 1: 153,630,777 (GRCm39) V431E probably damaging Het
Rps2 T A 17: 24,940,227 (GRCm39) D220E probably benign Het
Rsf1 T C 7: 97,331,059 (GRCm39) probably benign Het
Rsph10b G T 5: 143,913,952 (GRCm39) A710S probably benign Het
Sez6 A T 11: 77,844,353 (GRCm39) T59S probably damaging Het
Sf3b1 A T 1: 55,039,444 (GRCm39) V727E probably damaging Het
Slit2 T G 5: 48,407,140 (GRCm39) L857R probably damaging Het
Spata31g1 T A 4: 42,972,097 (GRCm39) S477T probably benign Het
Sspo T G 6: 48,425,504 (GRCm39) C42G probably damaging Het
Strc C T 2: 121,201,470 (GRCm39) D1245N probably benign Het
Supv3l1 T A 10: 62,268,118 (GRCm39) T576S probably benign Het
Tecrl C T 5: 83,461,154 (GRCm39) R101Q probably benign Het
Tmeff2 A G 1: 51,220,952 (GRCm39) Y309C probably damaging Het
Tmem43 T A 6: 91,462,362 (GRCm39) W316R probably damaging Het
Tmigd3 T C 3: 105,821,554 (GRCm39) V141A probably benign Het
Trav9-1 T C 14: 53,725,584 (GRCm39) F8L probably benign Het
Trbv5 T G 6: 41,039,641 (GRCm39) F82C probably damaging Het
Ubtf T C 11: 102,205,802 (GRCm39) N41S possibly damaging Het
Uggt1 T C 1: 36,197,229 (GRCm39) T1225A probably benign Het
Vmn1r72 T C 7: 11,403,807 (GRCm39) R214G possibly damaging Het
Vmn2r12 T G 5: 109,234,522 (GRCm39) K563N possibly damaging Het
Vmn2r83 T C 10: 79,304,873 (GRCm39) S28P probably benign Het
Vwa8 T G 14: 79,438,552 (GRCm39) L1875R probably damaging Het
Xrcc6 T A 15: 81,913,866 (GRCm39) V64E probably damaging Het
Zfp292 T C 4: 34,811,835 (GRCm39) Y403C probably damaging Het
Zfp955a A T 17: 33,460,955 (GRCm39) H392Q probably damaging Het
Zfyve19 T C 2: 119,041,290 (GRCm39) S69P probably damaging Het
Other mutations in Ehmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ehmt2 APN 17 35,129,791 (GRCm39) missense probably damaging 1.00
IGL02398:Ehmt2 APN 17 35,127,455 (GRCm39) missense probably damaging 1.00
IGL02878:Ehmt2 APN 17 35,129,743 (GRCm39) missense probably damaging 1.00
IGL02928:Ehmt2 APN 17 35,129,798 (GRCm39) missense probably damaging 1.00
IGL03117:Ehmt2 APN 17 35,125,787 (GRCm39) missense possibly damaging 0.54
R0630:Ehmt2 UTSW 17 35,118,818 (GRCm39) missense probably benign 0.02
R0778:Ehmt2 UTSW 17 35,124,394 (GRCm39) missense probably damaging 0.99
R0909:Ehmt2 UTSW 17 35,125,480 (GRCm39) missense possibly damaging 0.95
R1402:Ehmt2 UTSW 17 35,125,757 (GRCm39) missense probably benign 0.21
R1402:Ehmt2 UTSW 17 35,125,757 (GRCm39) missense probably benign 0.21
R1405:Ehmt2 UTSW 17 35,125,553 (GRCm39) missense probably benign
R1405:Ehmt2 UTSW 17 35,125,553 (GRCm39) missense probably benign
R1693:Ehmt2 UTSW 17 35,125,386 (GRCm39) missense possibly damaging 0.88
R1855:Ehmt2 UTSW 17 35,129,752 (GRCm39) missense probably damaging 1.00
R2212:Ehmt2 UTSW 17 35,118,341 (GRCm39) missense probably benign
R2275:Ehmt2 UTSW 17 35,129,691 (GRCm39) missense possibly damaging 0.95
R3761:Ehmt2 UTSW 17 35,132,707 (GRCm39) missense probably damaging 0.97
R3827:Ehmt2 UTSW 17 35,125,741 (GRCm39) missense possibly damaging 0.95
R3915:Ehmt2 UTSW 17 35,122,443 (GRCm39) missense probably damaging 0.99
R4303:Ehmt2 UTSW 17 35,127,724 (GRCm39) missense possibly damaging 0.92
R4529:Ehmt2 UTSW 17 35,132,707 (GRCm39) missense probably damaging 0.97
R4651:Ehmt2 UTSW 17 35,132,790 (GRCm39) missense probably damaging 1.00
R4825:Ehmt2 UTSW 17 35,125,940 (GRCm39) missense probably benign
R5061:Ehmt2 UTSW 17 35,118,067 (GRCm39) nonsense probably null
R5158:Ehmt2 UTSW 17 35,130,640 (GRCm39) missense probably damaging 1.00
R5298:Ehmt2 UTSW 17 35,118,067 (GRCm39) nonsense probably null
R5299:Ehmt2 UTSW 17 35,118,067 (GRCm39) nonsense probably null
R5523:Ehmt2 UTSW 17 35,118,067 (GRCm39) nonsense probably null
R5524:Ehmt2 UTSW 17 35,118,067 (GRCm39) nonsense probably null
R5727:Ehmt2 UTSW 17 35,125,008 (GRCm39) missense possibly damaging 0.75
R5755:Ehmt2 UTSW 17 35,127,214 (GRCm39) missense probably benign 0.05
R5786:Ehmt2 UTSW 17 35,129,719 (GRCm39) missense probably damaging 1.00
R5951:Ehmt2 UTSW 17 35,118,357 (GRCm39) missense probably benign
R6036:Ehmt2 UTSW 17 35,118,067 (GRCm39) nonsense probably null
R6162:Ehmt2 UTSW 17 35,118,067 (GRCm39) nonsense probably null
R6708:Ehmt2 UTSW 17 35,118,875 (GRCm39) nonsense probably null
R6889:Ehmt2 UTSW 17 35,131,748 (GRCm39) missense probably damaging 1.00
R6943:Ehmt2 UTSW 17 35,130,406 (GRCm39) missense probably damaging 1.00
R7470:Ehmt2 UTSW 17 35,118,372 (GRCm39) missense possibly damaging 0.67
R8061:Ehmt2 UTSW 17 35,124,903 (GRCm39) missense possibly damaging 0.66
R8095:Ehmt2 UTSW 17 35,126,745 (GRCm39) missense probably damaging 1.00
R8169:Ehmt2 UTSW 17 35,122,339 (GRCm39) missense probably benign
R8175:Ehmt2 UTSW 17 35,130,396 (GRCm39) missense probably damaging 1.00
R8244:Ehmt2 UTSW 17 35,124,238 (GRCm39) missense probably damaging 1.00
R8350:Ehmt2 UTSW 17 35,127,667 (GRCm39) missense probably damaging 1.00
R8357:Ehmt2 UTSW 17 35,124,137 (GRCm39) small deletion probably benign
R8809:Ehmt2 UTSW 17 35,127,489 (GRCm39) missense probably damaging 1.00
R9034:Ehmt2 UTSW 17 35,122,417 (GRCm39) missense probably benign 0.00
R9594:Ehmt2 UTSW 17 35,118,740 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GGATACCCATTCTCTGGCTGTG -3'
(R):5'- TCAGAAGGACCTCAGCGATG -3'

Sequencing Primer
(F):5'- TTCTGGCCAGCAAGTCTG -3'
(R):5'- TCAGCGATGGCGGCACTAC -3'
Posted On 2022-06-09